How could the current and expanding knowledge of PGP bacteria, be exploited to set up ‘designer’ microbiomes to enhance plant growth and productivity? Name one challenge to setting up such a system?

a. Draw the reaction that takes place when a disulfide bond is formed. What conditions are required for this to occur? What is the major role of disulfide bonds? What kinds of proteins normally have disulfide bonds? Where do you expect to find ribonuclease, the enzyme used in Anfinsen’s famous experiment?

b. Ohm loops are also considered secondary structure. How does their structure differ from other secondary elements? What function do these loops serve? Where are loops typically found on proteins?

c. The fatty acid binding protein and bacterial porin exist in completely different environments, one hydrophobic and one hydrophilic, and also transport molecules with the opposite properties. Describe the structural features these proteins have in common and how this structure can serve these two opposing roles.

How do eukaryotes use chromatin remodeling to regulate transcription? Why have some cancers been shown to be associated with mutations in genes involved in chromatin remodeling?

Choose a living organism, and explain how it illustrates each of the characteristics of life.

Research and describe an organism or cell in which all 8 characteristics are not obvious. For example, coral looks like it does not move, red blood cells do not reproduce and have no DNA, frogs freeze in the winter and it therefore seems as if they do not maintain homeostasis, and so on.

Describe the missing feature, and explain how this organism still meets the criteria of a living thing.

Compare a living thing with a nonliving thing of your choice that has some of the characteristics that define life. For example, a car exhibits metabolism (burning gas and producing heat), a characteristic of life, but is not alive because it cannot reproduce.

Compare and contrast the following pairs based on the 8 characteristics that define life:

A rock and a snail

A lamp and a tree

Discuss some of the characteristics that fire shares with living things (it can grow, it metabolizes, and so on).

Which of the following types of inheritance involve epigenetic modifications?

Choose All That Apply (pts deducted for including incorrect answers)

You are assigned the task of determining the bacterial density of newly-grown culture. You decide that you will analyze the sample with two methods, spectrophotometry and dilution plating. Your results show the sample tested using spectrophotometry had a bacteria density that was roughly ten folds that of the plated sample. Please explain in detail.

COLLAPSE

You receive an specimen in the lab from a patient with an infected throat. Chronicle the steps you would take to identify the bacteria present, starting with what stains, culture media, selective and differential. you would use and why?

what do you think distinguishes our present understanding of epigenetics from Larmarck's, now debunked, theory referred to as the Inheritance of Acquired Characteristics Theory? How, in contrast, might our understandings of the epigenome actually give support to some elements of Lamarckism? What role does epigenetics play in the operation of Natural Selection?

class discussions about categories of biochemical molecules

Make the assumption that a cell has a 10% salt concentration inside its cytoplasm. What factors do you think would influence the rate of diffusion?

vegetative bacterial cells will be killed at _______Centigrade in ______ minutes

How do prokaryotic cells exhibit cellular differentiation? Describe one manner of differentiation and the purpose of such differentiation.

In the lecture on eugenics, we came across the ideas of both positive and negative eugenics. Do you think positive eugenics can achieve the stated goal of improving the quality of our society? Why, or why not? In your answer, be sure to reference the related concepts we covered in the course. Your response should demonstrate your understanding of the principles of inheritance and evolution.

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'

What is science, and how do we use it to solve real-world problems? What is science, and what is biology in particular?