Which of the following macromolecules would yield only one type of monomer after complete hydrolysis?

A. DNA

B. Glycogen

C. Lipoprotein

D. RNA

E. Triacylglycerol

The answer is B but can someone explain why that is the answer and the others are wrong?

Cloning is a major topic of debate. Briefly describe the process of cloning in the lab incorporating facts.

How is cloning involved in gene therapy?

Give a specific and detailed example of how gene therapy may be used to solve problems associated with genetic disorders. Discuss the benefits and possible hazards of gene therapy to human health.

What might be the benefits of cloning? What are potential dangers or threats associated with the widespread use of cloning? Discuss the ethics of cloning in its various proposed forms and uses. Discuss how cloning is related to GMOs.

Make a table listing the four major challenges to plants living on land. In the second column, list at least one plant adaptation for each challenge.

1. Suzie was curious about how productive college sophomores attending Penn State Main campus are in working on a math worksheet when listening to music. She decided to conduct an experiment. She picked five of her closest sophomore friends to participate. She had each of them bring a phone and headphones to listen to music. She gave them all a copy of the same calculus worksheet to work on and timed how long it took them to finish it correctly.

a. List three things wrong with Suzie’s experiment.

2. Explain the difference between a independent variable and a dependent variable. a. Provide an example of each in contexts of an experiment.

3. Give two reasons why ratio measurement is the best measurement system.

4. Define a random sample and convenience sample.

How is glycogen synthesis and breakdown a) reciprocally regulated to prevent the formation fo a futile cycle? and b) hormonally regulated to increase the supply of available ATP during times of stress?

MacConkey agar is selective and differential. Explain why they are selective and differential, and what is in the media that enables this to occur.

What results would you expect from plating the following microorganisms on MacConkey, and why?

A) Staphylococcus aureus

B) Serratia marcescens

C) Escherichia coli

- In what ways might algae benefit other organisms in the water?

- In what ways might algae harm other organisms?

- Suppose you are responsible for "cleaning up" a lake that is polluted with algae. What would you do, and why?

What component of the foraging process best explains the differences you see between the functional response of the predator on each of the prey types?

What kinds of materials obtained from a crime scene might contain DNA? (2 pts)

Consider the following DNA molecule

5ʹ CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3ʹ

3ʹ GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5ʹ

How many bp is the original fragment? (1 point)

The enzyme HaeIII has the following restriction site    5ʹ GG˅CC 3ʹ          

                                                                                3ʹ CC˄GG 5ʹ

If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point)

If digested with HaeIII, how many fragments are formed if the DNA is circular? (1 point)

Consider the following DNA molecule

5ʹ ATTCGCGAATTCGGTACCGAATTGGCAGATTCGCCGAATTCCCGTACGGAATTAGTTAAC 3ʹ

3ʹ TAAGCGCTTAAGCCATGGCTTAACCGTCTAAGCGGCTTAAGGGCATGCCTTAATCAATTG 5ʹ

How many bp is the original fragment? (1 point)

(Recognition site for EcoRI is given previously)

If digested with EcoRI, how many fragments are formed if the DNA is linear? (1 point)

If digested with EcoRI, how many fragments are formed if the DNA is circular? (1 point)

Using the results from question #2 (for linear DNA), draw the results on a gel( “—“ = the well). Well A contains the complete, intact, undigested sample/sequence; well B contains digested sample/sequence. (4 points)

A                 B

What is the relationship between a specimen's total body water (TBW) and the habitat it lives in?

Short Answer

As we have been learning during the semester all microorganism are unique and may have the ability to increase its pathogenicity dependent on the environment. This week we were introduced to hydrolytic enzymes, list two enzymes (enzymatic activity of Casease, enzymatic activity of Gelatinase) and their function. Using your critical thinking, explain why it is of importance to identify microorganism that have hydrolytic abilities.

The two anzymes is (enzymatic activity of Casease, enzymatic activity of Gelatinase)

Please use this paper to answer both the sub section question in detail please. this paper is avialbale online so thier is no plagirism

http://genesdev.cshlp.org/content/9/7/783.full.pdf

Q. It is mentioned that embryos produced by the cactSu/ cactSu females are fully viable, yet when injected with the cactΔPEST mRNA, they become dorsalized, sometimes quite strongly (Fig. 6B). Propose why this dorsalization would happen in these injected embryos.

Please use this paper to answer both the sub section question in detail please. this paper is avialbale online so thier is no plagirism

http://genesdev.cshlp.org/content/9/7/783.full.pdf

Q. How did the use of the cactSu and cactΔPEST versions of cactus helped to demonstrate the existence of two types of degradation that control the levels of Cactus protein.