What's the difference between the brain's (sensory) relationship with outer toes vs with middle toes? How is this so?

1. Theory of Aging: Somatic DNA Damage Theory. Discuss for or against and provide citation and references. Minimum 250 words.

research conservation efforts

“Endangered species in Canda,” Are any species likely to be extinct within the next 50 years? Pick one conservation effort and evaluate published reports. Is it likely that the species will recover and what are the major obstacles to overcome in order to achieve species preservation? Provide suggestions for research to be conducted for better management, as well as changes to management to improve odds of recovery for the species.

Show all calculations in a neat and organized manner. Be sure that I understand your logic. For your experiment you must treat 1 X 109 cells with 5 nM cycloheximide (MW=281.35). Cycloheximide is both toxic and expensive. You have counted the cells with a hemocytometer and found the following numbers when counting 5 “4x4” sections (each 4x4 is 0.004 µl) of a 1:10 dilution of you chlamy stock: 90, 103, 123, 99, 107.

1) What is the concentration of the initial Chlamy culture in cell/ml? _______________________

2) How many mls of cells of the culture must you use for the experiment? _____________________

3) Describe how you will treat the cells with cyclohexamide. Clearly show all calculations.

1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site.

2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence:

3’–ACTACACGACAGGCATAATT—5’ (DNA Template)

a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)
b. In which direction (left or right) would the promoter lie on the template strand? Why? (2 pts.)
c. What is the RNA sequence that would be produced by the template strand? (1 pt.)
d. What would be the sequence of amino acids in the polypeptide produced from the RNA strand from (c)? (2 pts.)




15) A spontaneous chemical reaction:

a) will never occur on its own

b) could occur on its own, but might take a long time

c) has to occur immediately

13) Disulfide bridges stabilize which of the following levels of protein structure?

a) primary

b) secondary

c) tertiary

d) all of the above

e) none of the above

d) has an overall positive free energy change (ΔG)

e) decreases entropy, according to the 2nd Law of Thermodynamics

14) In your research, you expose a culture of amoebae to mutating radiation and then isolate a mutant cell that is unable to move (it cannot crawl around), but otherwise grows, divides, and appears normal. You suspect that most likely, this cell has a mutation in a gene that encodes a protein involved in:

a) actin filament formation

b) microtubule formation

c) ribosome assembly

d) intermediate filament formation

e) DNA formation

A generous estimate of how much of our genome encodes an RNA accounts for only about 1/14th of its length; what else is in our genome?

At the end of class I made the calculation that showed only 250,000,000 base pairs of our genomes 3,400,000,000 bp. And I briefly introduced a few things we have discovered in what used to be considered 'junk' DNA. Before class on Tuesday, I'd like you to discover more about what research is discovering in this 'junk'. Is it useful? Is it bad? Are some hypotheses too far fetched? Remember to comment on other posts, particularly if you find the research unsubstantiated based on what you yourself read.

Describe in detail methods used to quantify biodiversity. Use both soil and plant science concepts and itree in your answers.

please describe in two paragraphs.

Please, I need a unique answer, use your own words (don't copy and paste, no handwritten notes)

give me Overview of Pharmacokinetic Properties of (Dexamethasone & how it's related to COVID-19)

Describe how antigen binding sites of BCRs or TCRs are formed, how they are similar and how they differ.

1. what are the two laws of thermodynamics?
2. Explain how these two laws are related to metabolism or biological process.

what do bacterial cells need in order for blue-white screening to work?

Read this article "Habitat fragmentation and the persistence of lynx populations in Washington state" by Koehler et al 2008. For each answer write a paragraphs, using strong arguments provided by the findings of these researchers.

1. Where was the study conducted? At what temporal and spatial scale? What is the goal that the researchers pursued in this study?

1. Provide a short but complete paragraph that addresses the following questions: What specific methods did the authors use to collect data on habitat selection by lynx? What variables they measured? What kind of analytical tools they used?
2. What are two important results on the patterns of use of habitat (habitat selection) by lynxes in the study area? For example, you may want to look at the affinities that lynxes have for certain type of habitat, canopy cover, plant species etc.

1. What is a possible explanation for each of these patterns of habitat use?

1. Given the characteristics of the areas that may still harbor populations of Lynx in Washington described in this study, what do you think would be the effects of increasing habitat fragmentation on these populations? In your opinion what is the future of the lynx population in Washington State?