1.The following data were obtained in a study of an enzyme known to follow Michaelis-Menten kinetics:
2/27/ 20
V0 (mol/min)
217 325 433 488 647
Substrate added (mmol/L)
0.8 2 4 6 1,000
The Km for
A) 1 mM., B) 1000mM, C) 2mM, D ) 4mM, E) 6mM
this enzyme is approximately:
2. To
A) the enzyme concentration.
B) the initial velocity of the catalyzed reaction at [S] >> Km.
C) the initial velocity of the catalyzed reaction at low [S].
D) the Km for the substrate.
E) both the enzyme concentration and the initial velocity of the catalyzed reaction at
[S] >> Km.
3. An enzyme that can convert glucose into fructose is a member of which class of enzymes?
A) Oxidoreductases, B)Transferase, C) Hydrolases, D) Lyases, E) Isomerases
4. Which amino acid is NOT capable using its side chain (R
group) to participate in general acid-base catalysis?
A) Asp, B) His, C) Ser, D) Val, E) Lys
calculate the turnover number of an enzyme, you need to know:
5. Treatment of methanol poisoning by using ethanol is an
example of what type of enzyme inhibition?
A) mixed inhibition, B) uncompetitive inhibition
C) noncompetitive inhibition D) Competitive inhibition, E) Suicide Inhibition
6. What functional groups are present on this molecule?
A) ether and aldehyde, B) Hydroxyl and Aldehyde, C) Hydroxyl and Carboxylic acid, D) hydroxyl and Ester , E) hydroxyl and ketone
7. Which statement about intrinsically disordered proteins is TRUE?
A) B) C)
D) E)
They contain small hydrophobic cores.
They represent misfolded conformations of cellular proteins.
They have no stable three-dimensional structure and therefore have
no cellular function.
They are responsible for proteostasis.
They can interact with multiple protein-binding partners and are
central to protein interaction networks.
8.
protein aggregate?
Which disease is NOT one characterized by or associated with an unfolded
A) Alzheimer disease, B) Diabetes, C) Parkinson Disuease
D) Scurvy, E) All of these diseases are linked to unfolded protein
aggregates
9. Which amino acid when repeated six to ten times at the N- or C-terminal ends of a protein allows that protein to bind to Ni2+ ions?
a.Glu, b. His, c. Ala, d. Tyr, e. Asp
10. The biochemical activity of a protein, such as its enzymatic activity, is called its _____ function.
a. phenotypic , b. genotypic, c. cellular, d. molecular, e. organismal
In: Biology
Sulfanilamide that resembles substrate of an enzyme inhibits the enzyme when added to the reaction mix. What type of inhibition is this
A) allosteric inhibition
B) competitive inhibition
C) excitatory allosteric control
D) noncompetitive inhibition
E) feedback inhibition
In: Biology
In: Biology
In this week’s lab you will look for examples of phenotypic variation within and between species of plants, using both your unassisted eye and a microscope. But what sorts of phenotypeswill you not be able to observe in lab, and might they be variable, too? In your answer, detail two other kinds of unobservable (with our methods) phenotype that might vary within and between species and give a concrete example of each.
In: Biology
PCR reactions are specific to particular pieces of
DNA. Which component of the reaction allows for this specificity?
Explain how.
Sanger Sequencing (also called chain termination and dideoxy-sequencing) utilizes special dideoxy nucleotides (ddNTPs). What is the difference between these special nucleotides and the dNTPs used in PCR?
What role do the ddNTPs play in the sequencing
reaction?
In: Biology
Neither Tsar Nicholas II nor his wife Empress Alexandra had the
disease known as hemophilia, characterized by being linked to sex.
Her daughter, the princess Anastasia didn't have it either, but
Zarevich Alexius, her brother, did.
a) Can it be assumed that Anastasia was "carrier" of the
information for the hemophilia?
b) Why?
c) If she had married her cousin Henry, who was a hemophiliac,
would it have been any of your sons or daughters? Specify possible
cases
In: Biology
5` - AGATTCTGAGTCGTGACTCGTACGTCATAACTT -3`
In: Biology
You just isolated a new strain of mutant mice, and preliminary mating suggest that the new mutant phenotype is not inherited in an autosomal fashion. Circumstantial evidence seems to indicate that the mutant phenotype may be following either an X-linked dominant or a mitochondrial-type inheritance pattern.
a.) What two informative crosses would you set up to distinguish between these two possibilities?
b.) How would the results distinguish between the two possibilities?
In: Biology
Testing the goodness of fit between the data and the Hardy Weinberg equilibrium model generated expectations.
4.1 In a species of bird, feather color is controlled by genes at a single locus, with the red feather allele dominant to the yellow feather allele. A population has 22 red and 14 yellow birds, with 9 of the red birds having a homozygous dominant genotype. Is this population in equilibrium?
Calculate p and q from the number of individuals of each genotype:
p = ____
q = ____
Calculate the expected frequency of each genotype if the population is in equilibrium:
_____ = Frequency of homozygous dominant individuals
_____ = Frequency of heterozygous individuals
_____ = Frequency of homozygous recessive individuals
Calculate the expected number of individuals of each genotype in a population of 36 birds if the gene is in equilibrium:
_____ = Number of homozygous dominant individuals
_____ = Number of heterozygous individuals
_____ = Number of homozygous recessive individuals
Test how well your data fits the expected values from the equilibrium model:
_____ = Chi-square test statistic
_____ = P value
_____ (y/n) in equilibrium?
4.2 In a species of mouse, tail length is controlled by genes at a single locus, with the long tail allele dominant to the short tail allele. A population has 49 long tail and 25 short tail mice, with 22 of the long tail mice having a homozygous dominant genotype. Is this population in equilibrium?
Calculate p and q from the number of individuals of each genotype:
p = _____
q = _____
Calculate the expected frequency of each genotype if the population is in equilibrium:
_____ = Frequency of homozygous dominant individuals
_____ = Frequency of heterozygous individuals
_____ = Frequency of homozygous recessive individuals
Calculate the expected number of individuals of each genotype in a population of 74 mice if the gene is in equilibrium:
_____ = Number of homozygous dominant individuals
_____ = Number of heterozygous individuals
_____ = Number of homozygous recessive individuals
Test how well your data fits the expected values from the equilibrium model:
_____ Chi-square test statistic
______ P value
_____ (y/n) in equilibrium?
4.3 In humans, the hitchhiker’s thumb trait is controlled
by genes at a single locus, with the non-hitchhiker’s thumb allele
dominant to the hitchhiker’s thumb allele. A population has 46
people that do not have the hitchhiker’s thumb and 21 that do. Of
the humans without a hitchhiker’s thumb, 19 have a homozygous
dominant genotype. Is this population in equilibrium?
Calculate p and q from the number of individuals of each genotype:
p = _____
q = _____
Calculate the expected frequency of each genotype if the population is in equilibrium:
_____ = Frequency of homozygous dominant individuals
_____ = Frequency of heterozygous individuals
_____ = Frequency of homozygous recessive individuals
Calculate the expected number of individuals of each genotype in a population of 67 humans if the gene is in equilibrium:
_____ = Number of homozygous dominant individuals
_____ = Number of heterozygous individuals
_____ = Number of homozygous recessive individuals
Test how well your data fits the expected values from the equilibrium model:
_____ Chi-square test statistic
______ P value
_____ (y/n) in equilibrium?
4.4 In a certain species of prickly pear, having straight
or curved spines is a trait controlled by genes at a single locus,
with the straight spine allele dominant to the curved spine allele.
A population of prickly pears has 37 individuals with straight
spines and 42 individuals with curved spines. Of the prickly pears
with straight spines, 12 have a homozygous dominant genotype. Is
this population in equilibrium?
Calculate p and q from the number of individuals of each genotype:
p = _____
q = _____
Calculate the expected frequency of each genotype if the population is in equilibrium:
_____ = Frequency of homozygous dominant individuals
_____ = Frequency of heterozygous individuals
_____ = Frequency of homozygous recessive individuals
Calculate the expected number of individuals of each genotype in a population of 79 prickly pear cacti if the gene is in equilibrium:
_____ = Number of homozygous dominant individuals
_____ = Number of heterozygous individuals
_____ = Number of homozygous recessive individuals
Test how well your data fits the expected values from the equilibrium model:
_____ Chi-square test statistic
______ P value
_____ (y/n) in equilibrium?
In: Biology
although moving onto land had its benefits plants,were faced with some major challenges if they were to be successful. please explain two benefits and two challenges they faced and describe adaptations they evolved to meet both
challenges faced by plants during their transition from water to land and the adaptations that they developed to over those challenges and what are the benefits of colonizing land
In: Biology
War on Cancer
The underlying assumption of most approaches contained within the War On Cancer is that we can find one cure for all cancers. Consider just two types of cancer: basal cell carcinoma and colon cancer. These are both caused by a combination of what particular alleles of certain genes a person is born with, and mutations that accumulate due to environmental exposure and the process of aging. Some of the genes are shared, and some differ between the diseases. How likely do you think it is that there is a single approach that can either prevent or cure both of these? How likely do you think it is that there is a single approach that can cure or prevent many cancers?
In: Biology
6c) Explain how eukaryotic organelles are able to transport materials between one another.
6d) Considering your answer from 6c, explain how cells are able to import and export large and larger amount of molecules across the plasma membrane.
In: Biology
You have isolated a strain of brewer’s yeast (Saccharomyces cerevisiae) in the lab for your second job at a hip new microbrew . You find that this strain ferments more efficiently and adds a superior flavor profile to your brews. You want to clone the strain of yeast and generate a genomic library to determine the genes responsible for this finding. To do so you:
Note: the cloning site is within the lacZ gene.
a) (3 points) In step 3 you transform E.coli with your plasmids and plate them on a solid agar medium to grow and isolate colonies. What medium should you used to distinguish the bacteria transformed with recombinant vectors from ones that carry non-recombinant vectors? Briefly explain how the medium allows for you to distinguish. (hint: look up the substrate X-gal)
b) (2 points) You identify a recombinant vector that passes your complementation test. You are curious whether this vector will cause bacteria to ferment sugars for brewing. Provide and explain two reasons why this recombinant vector will NOT work in bacteria.
In: Biology
. For each of the restriction enzymes listed below: (i) Approximately how many restriction fragments would result from digestion of the human genome (3 x 109 bases) with the enzyme? (ii) State whether the fragments produced by digestion with each enzyme would have sticky ends with a 5’ overhang, sticky ends with a 3’ overhang, or blunt ends. (The recognition sequence for each enzyme is given in parentheses, where N means any of the four nucleotides. ^ marks the site of cleavage.)
a. EcoRV (GAT^ATC)
b. HpaII (C^CGG)
c. DrdI (GACNNNN^NNGTC)
In: Biology
(h) Pseudomonas aeruginosa also uses the Entner-Doudoroff pathway to degrade glucose. Use IMG or BLAST (or MetaCyc) to identify which enzymes in the EMP pathway are missing from P. aeruginosa PAO1.
(i) Biochemical experiments performed by Robertson and McCullough (1968) suggested that Brucella abortus uses the pentose phosphate pathway, instead of the EMP or Entner-Doudoroff pathway, to degrade glucose. The labeling and enzymological results, obtained with B. abortus strain 19 grown in rich media in shaken culture, suggested that key enzymes are missing. Use IMG or BLAST (or MetaCyc) to identify which enzymes in the EMP and ED pathways are missing from B. abortus S19. Is there a discrepancy from experimental results? Explain.
Please only answer if you know the answer. Appreciated
In: Biology