What host environmental factors contribute to the spread of these organisms Neisseria meningitidis and Mycobacterium tuberculolosis ? How might these factors contribute to the growth of each organism?

How do we use our knowledge of edge effects to plan the reserves? What information do you need?

Ice has also been observed to increase polymerization. This seems counter-intuitive because molecular motion decreases at colder temperatures. So how could freezing a solution actually increase reaction rates?

review Szostak and Battel’s experiment on RNA evolution. Put this process into Darwin’s 4 points.   

Explain the hypothetical genetic copying scenario outlined using convection currents in pools. How is this similar to PCR?

1. What was used before enzymes, if anything before celiac disease and lactose intolerance.

2. Discuss why lactase are being used:Does it have higher yields and less waste?

In Drosophila (fruit flies) the genes how, dumpy and ebony are located on chromosome 3. LOF = loss of function.

• Flies homozygous for a LOF mutation (no gene product made) in ebony have dark black bodies.
• Flies homozygous for a LOF mutation (no gene product made) in dumpyhave truncated (short) wings.
• Flies homozygous for a partial LOF mutation (some gene product made but significantly less than normal) in how have wings that will not fold down (held out wings; that's where the gene name is coming from, how).

Use the following allele/phenotype designations:

For how

• allele h+ = wild type/normal
• allele h = partial loss of function mutation
• h+ > h
• phenotype h+ = wild type = wings that fold, which is dominant to held out wings = phenotype h

For dumpy

• allele dp+ = wild type/normal
• allele dp = LOF mutation
• dp+ > dp
• phenotype dp+ = wild type = normal wing size, which is dominant to truncated wings = phenotype dp

For ebony

• allele eb+ = wild type/normal
• allele eb = LOF mutation
• eb+ > eb
• phenotype eb+ = wild type = normal body colour, which is dominant to black body = phenotype eb

You cross a wild type female fruit fly that is a heterozygous carrier for all three mutant alleles with a black bodied male who has truncated wings that do not fold down.

You observe their 504 offspring and note their phenotypes and the number of offspring with each phenotype:

• wings that do not fold - 129
• truncated wings - 83
• black body - 6
• wings that do not fold and a black body - 80
• truncated wings that do not fold - 10
• truncated wings and a black body - 135
• truncated wings that do not fold, and a black body - 15
• wild type - 14

Note: that non-mutant phenotypes are generally ignored. For example a phenotype of "black body" means a fly with a black body, normal wing length and wings that fold.

Flies homozygous for a partial LOF mutation (some gene product made but significantly less than normal) in how have wings that will not fold down (held out wings; that's where the gene name is coming from, how).

But there is another mutation in how that is a complete loss of function (no gene product made). The complete LOF mutation is represented as h-; h- is recessive lethal. Flies homozygous for the complete loss of function mutation (h-/h-) die when trying to emerge from their pupal cases. Basically, you won't see h-/h- adult flies because they are all dead.

You mate two wild type flies who are both carriers for the dumpy LOF mutation (dp) and the complete LOF how mutation (h-). They both have the same genotype: h- dp / h+ dp+.

Q. How many of the resulting larvae (offspring) will be h- / h-, if the genotype at dumpy doesn't matter? Remember, the complete loss of function mutant dies when coming out of its pupal case, the larval stage is before the pupal stage.

Select one:

a. 1/4

b. 0

c. 1/2

d. 1/500

Pick one trace element, learn about it, write about it (200 – 300 words), and include citations.

What's the difference between the brain's (sensory) relationship with outer toes vs with middle toes? How is this so?

1. Theory of Aging: Somatic DNA Damage Theory. Discuss for or against and provide citation and references. Minimum 250 words.

research conservation efforts

“Endangered species in Canda,” Are any species likely to be extinct within the next 50 years? Pick one conservation effort and evaluate published reports. Is it likely that the species will recover and what are the major obstacles to overcome in order to achieve species preservation? Provide suggestions for research to be conducted for better management, as well as changes to management to improve odds of recovery for the species.

Show all calculations in a neat and organized manner. Be sure that I understand your logic. For your experiment you must treat 1 X 109 cells with 5 nM cycloheximide (MW=281.35). Cycloheximide is both toxic and expensive. You have counted the cells with a hemocytometer and found the following numbers when counting 5 “4x4” sections (each 4x4 is 0.004 µl) of a 1:10 dilution of you chlamy stock: 90, 103, 123, 99, 107.

1) What is the concentration of the initial Chlamy culture in cell/ml? _______________________

2) How many mls of cells of the culture must you use for the experiment? _____________________

3) Describe how you will treat the cells with cyclohexamide. Clearly show all calculations.

1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site.

2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence:

3’–ACTACACGACAGGCATAATT—5’ (DNA Template)

a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)
b. In which direction (left or right) would the promoter lie on the template strand? Why? (2 pts.)
c. What is the RNA sequence that would be produced by the template strand? (1 pt.)
d. What would be the sequence of amino acids in the polypeptide produced from the RNA strand from (c)? (2 pts.)




15) A spontaneous chemical reaction:

a) will never occur on its own

b) could occur on its own, but might take a long time

c) has to occur immediately

13) Disulfide bridges stabilize which of the following levels of protein structure?

a) primary

b) secondary

c) tertiary

d) all of the above

e) none of the above

d) has an overall positive free energy change (ΔG)

e) decreases entropy, according to the 2nd Law of Thermodynamics

14) In your research, you expose a culture of amoebae to mutating radiation and then isolate a mutant cell that is unable to move (it cannot crawl around), but otherwise grows, divides, and appears normal. You suspect that most likely, this cell has a mutation in a gene that encodes a protein involved in:

a) actin filament formation

b) microtubule formation

c) ribosome assembly

d) intermediate filament formation

e) DNA formation

A generous estimate of how much of our genome encodes an RNA accounts for only about 1/14th of its length; what else is in our genome?

At the end of class I made the calculation that showed only 250,000,000 base pairs of our genomes 3,400,000,000 bp. And I briefly introduced a few things we have discovered in what used to be considered 'junk' DNA. Before class on Tuesday, I'd like you to discover more about what research is discovering in this 'junk'. Is it useful? Is it bad? Are some hypotheses too far fetched? Remember to comment on other posts, particularly if you find the research unsubstantiated based on what you yourself read.