QUESTION 6

1. These correct “overwinding” ahead of the replication forks by breaking, swiveling, and rejoining DNA strands.

   		Helicases
   		Single-strand binding proteins
   		Topoisomerase
   		Telomerase

4 points   

QUESTION 7

1. An organism that is heterozygous for two traits with the genotype AaBb can form sperm with all of the following genotypes except:

   		Aa
   		AB
   		aB
   		ab

4 points   

QUESTION 8

1. Which of the following prevents shortening of eukaryotic chromosomal ends?

   		Helicases
   		Telomerase
   		Topoisomerase
   		Beta-clamps

4 points   

QUESTION 9

1. These are enzymes that untwist the double helix at the replication forks of replicating DNA.

   		Helicases
   		Stingle-strand binding proteins
   		Topoisomerase
   		Telomerase

4 points   

QUESTION 10

1. Where does translation occur in eukaryotic cells?

   		in the nucleus
   		in the cytoplasm
   		at the golgi apparatus
   		at the plasma membrane

Look at the major divisions of the brain and the developing neural tube. Do you see a pattern in the position of each tube and the functions of the major brain divisions?

Using the sequence of the BPSL1549 protein – carry out an NCBI BLAST search using an appropriate BLAST program for the type of input sequence and restrict your search to the non redundant protein sequences (nr) database.What does the list of significant alignments tell you? Select all that apply. *

• Most of the hits appears to belong mainly in the genus Burkholderia.
• There appears to be a B. mallei homolog that has an acceptable E value but only has a query coverage of 18%.
• There is one significant homolog of the protein from Skemanella stibiiresistens.
• The protein could in theory be used as a drug against cancer cells although it hasn't been proven.
• The protein is possibly a toxin.

We’ve seen in this lab exercise that proteins can be involved in more than one biological process or KEGG pathway. Based on what you’ve learned in Cell Biology Lecture or Lab, describe a protein that has a role in multiple processes or pathways. Include in your answer the name of the protein and in which pathway or process it is involved.

1.The following data were obtained in a study of an enzyme known to follow Michaelis-Menten kinetics:

2/27/ 20

V0 (mol/min)

   217
   325
   433
   488
   647

Substrate added (mmol/L)

0.8 2 4 6 1,000

The Km for
A) 1 mM., B) 1000mM, C) 2mM, D ) 4mM, E) 6mM

this enzyme is approximately:

2. To

1. A) the enzyme concentration.

2. B) the initial velocity of the catalyzed reaction at [S] >> Km.

3. C) the initial velocity of the catalyzed reaction at low [S].

4. D) the Km for the substrate.

5. E) both the enzyme concentration and the initial velocity of the catalyzed reaction at

   [S] >> Km.

3. An enzyme that can convert glucose into fructose is a member of which class of enzymes?

A) Oxidoreductases, B)Transferase, C) Hydrolases, D) Lyases, E) Isomerases

4. Which amino acid is NOT capable using its side chain (R group) to participate in general acid-base catalysis?
A) Asp, B) His, C) Ser, D) Val, E) Lys

calculate the turnover number of an enzyme, you need to know:

5. Treatment of methanol poisoning by using ethanol is an example of what type of enzyme inhibition?
A) mixed inhibition, B) uncompetitive inhibition

C) noncompetitive inhibition D) Competitive inhibition, E) Suicide Inhibition

6. What functional groups are present on this molecule?

A) ether and aldehyde, B) Hydroxyl and Aldehyde, C) Hydroxyl and Carboxylic acid, D) hydroxyl and Ester , E) hydroxyl and ketone

7. Which statement about intrinsically disordered proteins is TRUE?

A) B) C)

D) E)

They contain small hydrophobic cores.
They represent misfolded conformations of cellular proteins.
They have no stable three-dimensional structure and therefore have no cellular function.
They are responsible for proteostasis.
They can interact with multiple protein-binding partners and are central to protein interaction networks.

8.
protein aggregate?

Which disease is NOT one characterized by or associated with an unfolded

A) Alzheimer disease, B) Diabetes, C) Parkinson Disuease
D) Scurvy, E) All of these diseases are linked to unfolded protein aggregates

9. Which amino acid when repeated six to ten times at the N- or C-terminal ends of a protein allows that protein to bind to Ni2+ ions?

a.Glu, b. His, c. Ala, d. Tyr, e. Asp

10. The biochemical activity of a protein, such as its enzymatic activity, is called its _____ function.

a. phenotypic , b. genotypic, c. cellular, d. molecular, e. organismal

Sulfanilamide that resembles substrate of an enzyme inhibits the enzyme when added to the reaction mix. What type of inhibition is this

A) allosteric inhibition

B) competitive inhibition

C) excitatory allosteric control

D) noncompetitive inhibition

E) feedback inhibition

In this week’s lab you will look for examples of phenotypic variation within and between species of plants, using both your unassisted eye and a microscope. But what sorts of phenotypeswill you not be able to observe in lab, and might they be variable, too? In your answer, detail two other kinds of unobservable (with our methods) phenotype that might vary within and between species and give a concrete example of each.

Neither Tsar Nicholas II nor his wife Empress Alexandra had the disease known as hemophilia, characterized by being linked to sex. Her daughter, the princess Anastasia didn't have it either, but Zarevich Alexius, her brother, did.
a) Can it be assumed that Anastasia was "carrier" of the information for the hemophilia?
b) Why?
c) If she had married her cousin Henry, who was a hemophiliac, would it have been any of your sons or daughters? Specify possible cases

1. Using your knowledge of DNA replication, copy the following. Write down all the important steps and players of the reaction. Show the primer location and derive the complimentary strand sequence.

5` - AGATTCTGAGTCGTGACTCGTACGTCATAACTT -3`

You just isolated a new strain of mutant mice, and preliminary mating suggest that the new mutant phenotype is not inherited in an autosomal fashion. Circumstantial evidence seems to indicate that the mutant phenotype may be following either an X-linked dominant or a mitochondrial-type inheritance pattern.

a.) What two informative crosses would you set up to distinguish between these two possibilities?

b.) How would the results distinguish between the two possibilities?

Testing the goodness of fit between the data and the Hardy Weinberg equilibrium model generated expectations.

4.1 In a species of bird, feather color is controlled by genes at a single locus, with the red feather allele dominant to the yellow feather allele. A population has 22 red and 14 yellow birds, with 9 of the red birds having a homozygous dominant genotype. Is this population in equilibrium?

Calculate p and q from the number of individuals of each genotype:

p = ____

q = ____

Calculate the expected frequency of each genotype if the population is in equilibrium:

_____ = Frequency of homozygous dominant individuals

_____ = Frequency of heterozygous individuals

_____ = Frequency of homozygous recessive individuals

Calculate the expected number of individuals of each genotype in a population of 36 birds if the gene is in equilibrium:

_____   = Number of homozygous dominant individuals

_____   = Number of heterozygous individuals

_____ = Number of homozygous recessive individuals

Test how well your data fits the expected values from the equilibrium model:

_____ = Chi-square test statistic

_____ = P value

_____ (y/n) in equilibrium?

4.2 In a species of mouse, tail length is controlled by genes at a single locus, with the long tail allele dominant to the short tail allele. A population has 49 long tail and 25 short tail mice, with 22 of the long tail mice having a homozygous dominant genotype. Is this population in equilibrium?

Calculate p and q from the number of individuals of each genotype:

p = _____

q = _____

Calculate the expected frequency of each genotype if the population is in equilibrium:

_____   = Frequency of homozygous dominant individuals

_____   = Frequency of heterozygous individuals

_____   = Frequency of homozygous recessive individuals

Calculate the expected number of individuals of each genotype in a population of 74 mice if the gene is in equilibrium:

_____   = Number of homozygous dominant individuals

_____   = Number of heterozygous individuals

_____   = Number of homozygous recessive individuals

Test how well your data fits the expected values from the equilibrium model:

_____ Chi-square test statistic

______ P value

_____ (y/n) in equilibrium?

4.3 In humans, the hitchhiker’s thumb trait is controlled by genes at a single locus, with the non-hitchhiker’s thumb allele dominant to the hitchhiker’s thumb allele. A population has 46 people that do not have the hitchhiker’s thumb and 21 that do. Of the humans without a hitchhiker’s thumb, 19 have a homozygous dominant genotype. Is this population in equilibrium?

Calculate p and q from the number of individuals of each genotype:

p = _____

q = _____

Calculate the expected frequency of each genotype if the population is in equilibrium:

_____   = Frequency of homozygous dominant individuals

_____   = Frequency of heterozygous individuals

_____   = Frequency of homozygous recessive individuals

Calculate the expected number of individuals of each genotype in a population of 67 humans if the gene is in equilibrium:

_____   = Number of homozygous dominant individuals

_____   = Number of heterozygous individuals

_____   = Number of homozygous recessive individuals

Test how well your data fits the expected values from the equilibrium model:

_____   Chi-square test statistic

______ P value

_____ (y/n) in equilibrium?

4.4 In a certain species of prickly pear, having straight or curved spines is a trait controlled by genes at a single locus, with the straight spine allele dominant to the curved spine allele. A population of prickly pears has 37 individuals with straight spines and 42 individuals with curved spines. Of the prickly pears with straight spines, 12 have a homozygous dominant genotype. Is this population in equilibrium?

Calculate p and q from the number of individuals of each genotype:

p = _____

q = _____

Calculate the expected frequency of each genotype if the population is in equilibrium:

_____   = Frequency of homozygous dominant individuals

_____   = Frequency of heterozygous individuals

_____   = Frequency of homozygous recessive individuals

Calculate the expected number of individuals of each genotype in a population of 79 prickly pear cacti if the gene is in equilibrium:

_____   = Number of homozygous dominant individuals

_____   = Number of heterozygous individuals

_____   = Number of homozygous recessive individuals

Test how well your data fits the expected values from the equilibrium model:

_____   Chi-square test statistic

______ P value

_____ (y/n) in equilibrium?

although moving onto land had its benefits plants,were faced with some major challenges if they were to be successful. please explain two benefits and two challenges they faced and describe adaptations they evolved to meet both

challenges faced by plants during their transition from water to land and the adaptations that they developed to over those challenges and what are the benefits of colonizing land

War on Cancer

The underlying assumption of most approaches contained within the War On Cancer is that we can find one cure for all cancers. Consider just two types of cancer: basal cell carcinoma and colon cancer. These are both caused by a combination of what particular alleles of certain genes a person is born with, and mutations that accumulate due to environmental exposure and the process of aging. Some of the genes are shared, and some differ between the diseases. How likely do you think it is that there is a single approach that can either prevent or cure both of these? How likely do you think it is that there is a single approach that can cure or prevent many cancers?