Question

1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site.

2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence:

3’–ACTACACGACAGGCATAATT—5’ (DNA Template)

a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)
b. In which direction (left or right) would the promoter lie on the template strand? Why? (2 pts.)
c. What is the RNA sequence that would be produced by the template strand? (1 pt.)
d. What would be the sequence of amino acids in the polypeptide produced from the RNA strand from (c)? (2 pts.)




Answer 1

1. Translation is the process of converting an mRNA transcript into a protein(or a polypeptide) with the help of ribosomes and amino acid carrying tRna. It takes place in the cytoplasm of the cell in eukaryotes and in the nucleoid region of the prokaryotes. Ribosome containing 2 subunits(large and small) has three sites by which it mediates the elongation of the polypeptide chain, they are A, P and E sites

The following events takes place when a codon that specifies the amino acid enters the A site of the ribosome

1. binding of charged tRNA with the mRNA by complemetary base pairing in the A site
2. coupling of amino acids in the P-site tRNA with the amino acid in the A site tRNA by the formation of peptide bond and simultaneously breaking down of the bond between the amino acid and the tRNA in the P site
3. The uncharged tRNA is then moved to E site and thereby it leaves the ribosome machinery

Following events takes place when a stop codon enters the A site

1. When a stop codon reaches the A site then an uncharged tRNA binds to the mRNA by complementay base paring
2. The polypeptide carried by the P site tRNA will not be coupled to tRNA in the A site and therefore it gets released and the bound tRNAs in the P site and A site will exit through the E site
3. Then a release factor will bind to the A site thereby disassembling the ribosomal machinery from the mRNA

2. Since both strands of DNA are complemetary to each other and always A bind to T and C binds to G by Chargaff's rule

a) The DNA sequence of the non-template (coding) strand is given as follows 5'-TGATGTGCTGTCCGTATTAA-3'

b) The promoter lie on the left side i.e. on the 3' end of the DNA template strand as transcription by DNA dependant RNA polymerase occurs only on the 5' to 3' direction

c) The RNA sequence produced by the template strand is same as that of non-template strand except that T(Thymidine) is replaced by U(Uridine). Therefore, the sequence of RNA is as follows 5'-UGAUGUGCUGUCCGUAUUAA-3'

d) The polypeptide sequence of the mRNA transcript above is as follows N-terminal end - MCCPY - C-terminal end, where AUG is the initiator codon of the forward frame 3 and UAA is the stop codon.

One letter code of Amino acids	Amino acid
M	Methionine
C	Cysteine
P	Proline
Y	Tyrosine