1. Please explain how the sequence of events that occurs when a codon that specifies an...

1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site.

2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence:

3’–ACTACACGACAGGCATAATT—5’ (DNA Template)

a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)
b. In which direction (left or right) would the promoter lie on the template strand? Why? (2 pts.)
c. What is the RNA sequence that would be produced by the template strand? (1 pt.)
d. What would be the sequence of amino acids in the polypeptide produced from the RNA strand from (c)? (2 pts.)   

Expert Solution

1. Translation is the process of converting an mRNA transcript into a protein(or a polypeptide) with the help of ribosomes and amino acid carrying tRna. It takes place in the cytoplasm of the cell in eukaryotes and in the nucleoid region of the prokaryotes. Ribosome containing 2 subunits(large and small) has three sites by which it mediates the elongation of the polypeptide chain, they are A, P and E sites

The following events takes place when a codon that specifies the amino acid enters the A site of the ribosome

binding of charged tRNA with the mRNA by complemetary base pairing in the A site
coupling of amino acids in the P-site tRNA with the amino acid in the A site tRNA by the formation of peptide bond and simultaneously breaking down of the bond between the amino acid and the tRNA in the P site
The uncharged tRNA is then moved to E site and thereby it leaves the ribosome machinery

Following events takes place when a stop codon enters the A site

When a stop codon reaches the A site then an uncharged tRNA binds to the mRNA by complementay base paring
The polypeptide carried by the P site tRNA will not be coupled to tRNA in the A site and therefore it gets released and the bound tRNAs in the P site and A site will exit through the E site
Then a release factor will bind to the A site thereby disassembling the ribosomal machinery from the mRNA

2. Since both strands of DNA are complemetary to each other and always A bind to T and C binds to G by Chargaff's rule

a) The DNA sequence of the non-template (coding) strand is given as follows 5'-TGATGTGCTGTCCGTATTAA-3'

b) The promoter lie on the left side i.e. on the 3' end of the DNA template strand as transcription by DNA dependant RNA polymerase occurs only on the 5' to 3' direction

c) The RNA sequence produced by the template strand is same as that of non-template strand except that T(Thymidine) is replaced by U(Uridine). Therefore, the sequence of RNA is as follows 5'-UGAUGUGCUGUCCGUAUUAA-3'

d) The polypeptide sequence of the mRNA transcript above is as follows N-terminal end - MCCPY - C-terminal end, where AUG is the initiator codon of the forward frame 3 and UAA is the stop codon.

One letter code of Amino acids	Amino acid
M	Methionine
C	Cysteine
P	Proline
Y	Tyrosine

gladiator answered 1 year ago

Please explain how the sequence of events that occurs when a codon that specifies an amino...

Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site.

describe the correct sequence of events that occurs when the government of a nation that was...

describe the correct sequence of events that occurs when the government of a nation that was originally in equilibrium raises its personal income tax rates. Be sure to mention which curve (AD or SRAS) shifts, which way that curve shifts and the impact that it would have on the nation's price level and Real GDP.

1) Write in order the sequence of events that occurs during muscle contraction. Begin in the...

1) Write in order the sequence of events that occurs during muscle contraction. Begin in the brain and include all action in the muscle. You can write it out like a flow chart, one action followed by the next. 2.The function of the T tubules is to _________. A) Store Ca2+ inside the muscle fiber. B) Rapidly conduct action potentials to the interior of the muscle fiber. C) To store neurotransmitter D) Conduct ATP molecules out of the mitochondria throughout...

1. Please briefly explain the following. a.) Discuss the sequence of events in the B-cell response...

1. Please briefly explain the following. a.) Discuss the sequence of events in the B-cell response to a thymus-dependent antigen. b.) Discuss the structure and function of class I and II MHC molecules. c.) Discuss the development of T cells in the thymus.

13. Describe the basic sequence of events that occurs as an action potential arrives at the...

13. Describe the basic sequence of events that occurs as an action potential arrives at the neuromuscular junction and is transmitted to the muscle cell and leads to a contraction. Explain at the end how relaxation of the muscle takes place (include what happens at the neuromuscular junction and in the muscle fiber. You may use some words multiple times. Fill in the blanks with a complete word or words (no abbreviations) of each step. 1. An action potential arrives...

. Describe the V(D)J recombination process in terms of the sequence of events that occurs and...

. Describe the V(D)J recombination process in terms of the sequence of events that occurs and the enzymes involved at each step (4 points). Describe why V(D)J recombination is crucial for adaptive immunity

Which of the following correctly describes the sequence of events that occurs once a neuron’s threshold...

Which of the following correctly describes the sequence of events that occurs once a neuron’s threshold for forming an action potential is reached? A. Sodium enters the neuron, followed by potassium leaving the neuron. B. Sodium enters the neuron at the same time that potassium leaves the neuron. C. Potassium enters the neuron, followed by sodium leaving the neuron. D. Potassium enters the neuron at the same time that sodium leaves the neuron Please explain the answer in 200 words...

18). Explain the events that occur in sequence from when an efferent (motor) neuron releases ACh...

18). Explain the events that occur in sequence from when an efferent (motor) neuron releases ACh to the motor end plate of a skeletal muscle cell until calcium ions contact troponin. 19). Describe the differences between muscle atrophy & muscle hypertrophy & give at least two (2) causes for each condition. 20). Describe four (4) causes of skeletal muscle fatigue.

1. Cognitive bias occurs when people exaggerate the probability of very rare events if their consequences...

1. Cognitive bias occurs when people exaggerate the probability of very rare events if their consequences are catastrophic. How does the availability heuristic enhance this kind of bias? 2. How does the focus of the cognitive theories of intelligence differ from the focus of psychometric theories? How do the two approaches define intelligence? 3. One of the longest-running psychological studies ever conducted was begun by Lewis Terman in 1921 in order to learn about children who scored in the top...

Number the events below 1 – 7 to represent the correct sequence of events in skeletal...

Number the events below 1 – 7 to represent the correct sequence of events in skeletal muscle contraction and relaxation ___Ca2+ binds to troponin; tropomyosin moves, exposing the active site of actin ___Acetylcholine (ACh) triggers an end-plate potential in the motor end plate. ___ The motor neuron stops releasing ACh and Acetylcholinesterase degrades the ACh in the synaptic cleft ___An Action potential in the sarcolemma travels down the T-Tubules ___ Ca2+ is released from the sarcoplasmic reticulum into the cytosol...

Question