Question

In: Biology

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following...

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following questions refer to a PCR reaction designed to amplify the DNA helix below.

Region 1 Region 2

5’ GCTAGCTGTGGCTTAATATAGCCCGCAGTAGCGT 3’

b. While mixing up the PCR reaction mix, you accidentally add too little of the concentrated buffer, thus producing a lower than anticipated ion concentration. To compensate, you should (INCREASE/DECREASE/NOT ALTER) the denaturation temperature. Which of the explanations below best supports your answer?

A. There is going to be increased repulsion between the strands.

B. There is going to be decreased repulsion between the strands.

C.There is going to be charge associated with the DNA bases.

Solutions

Expert Solution

b. DNA denaturation refers to the breaking of hydrogen bonds between the bases of a double-stranded DNA molecule to generate two single strands.

During mixing up the PCR reaction mix, accidentally added too little of the concentrated buffer, produced the lower ion concentration than the anticipated ion concentration. To compensate for this, we should decrease the denaturation temperature.

As ion concentration is low, less ion is present to shield the negative(-ve) charge on the phosphate(P) backbone. That means there will be more repulsion (due to less shielding effect of ions) and less heat will be required to denature the DNA.

The best supportive explanation is A. There is going to be increased repulsion between the strands.

gladiator answered 2 years ago
Next > < Previous

Related Solutions

PCR can generate over 100 _________________ copies of DNA in hours. ____, _____, _____, and _____...
PCR can generate over 100 _________________ copies of DNA in hours. ____, _____, _____, and _____ are the nucleotides needed to ______ copies of DNA Why do we need to add primers? What can DNA Polymerase withstand that other enzymes cannot? When do your desired fragments start to appear? On cycle ________________, you have over a billion copies of DNA. What is the purpose of the agarose gel? What makes the DNA move? DNA migrates to the _________________ end of...
If you would do a PCR experiment using the Klenow fragment of the E.coli DNA polymerase...
If you would do a PCR experiment using the Klenow fragment of the E.coli DNA polymerase I instead of Taq DNA polymerase, what would you have to change in the experimental set-up and explain why?
In a linear fragment of DNA, the ends can not be replicated by DNA polymerases.
  What are the SD sequences? Found in the promoters of RNA polymerase I Found in the promoters of RNA polymerase II Found in the promoters of RNA polymerase III Ribosome binding sites in prokaryotic mRNA Ribosome binding sites in eukaryotic mRNA In a linear fragment of DNA, the ends can not be replicated by DNA polymerases.      Eukaryotes use telomerase enzyme to replicate chromosome tips. This enzyme has DNA polymerase activity RNA polymerase activity Reverse transcriptase activity DNA ligase...
matching fragment DNA at specific sites hybridize DNA fragments with labeled probe create DNA features on...
matching fragment DNA at specific sites hybridize DNA fragments with labeled probe create DNA features on a DNA microchip prepare mRNA for DNA sequencing transform eukaryotic cells with electricity detect the amount of or the 5’ end of mRNA visualize DNA, RNA or other small structures a type of electrophoresis detect protein binding to DNA use antibody to detect a specific protein use antibody to purify a specific protein amplify a specific locus of DNA adding transformed ES to blastocyst...
6.- Your friend Silvester wishes to subclone a 1.7 kb DNA fragment into the pCR 2.1...
6.- Your friend Silvester wishes to subclone a 1.7 kb DNA fragment into the pCR 2.1 TOPO plasmid vector. His goal is to amplify the desired fragment by PCR. At the end of the PCR cycling reaction, he immediately adds 4 ?L of PCR reaction, (the maximum of DNA allowable) to the ligation mix. He did the transformation and plated it onto solid media containing the right amount of X-gal and ampicillin. He picked a single white colony, inoculated it...
​​​​​​​Describe how you can use PCR to obtain a gene fragment X that can be cloned...
​​​​​​​Describe how you can use PCR to obtain a gene fragment X that can be cloned into a plasmid vector for expression of the recombinant protein. Include in your description how the PCR reaction will be performed, how the amplicon will be analyzed, the use of restriction enzymes, how cloning will be achieved, how you will know that you have a recombinant containing the insert gene fragment X and how you will detect the recombinant protein.
Describe how you can use PCR to obtain a gene fragment X that can be cloned...
Describe how you can use PCR to obtain a gene fragment X that can be cloned into a plasmid vector for expression of the recombinant protein. Include in your description how the PCR reaction will be performed, how the amplicon will be analyzed, the use of restriction enzymes, how cloning will be achieved, how you will know that you have a recombinant containing the insert gene fragment X and how you will detect the recombinant protein.
Can DNA be amplified from a degraded sample for PCR?
Can DNA be amplified from a degraded sample for PCR?
PCR reactions are specific to particular pieces of DNA. Which component of the reaction allows for...
PCR reactions are specific to particular pieces of DNA. Which component of the reaction allows for this specificity? Explain how. Sanger Sequencing (also called chain termination and dideoxy-sequencing) utilizes special dideoxy nucleotides (ddNTPs). What is the difference between these special nucleotides and the dNTPs used in PCR? What role do the ddNTPs play in the sequencing reaction?
One can take a fragment of genomic DNA carrying a eukaryotic gene and clone it into...
One can take a fragment of genomic DNA carrying a eukaryotic gene and clone it into a bacterial plasmid, containing an origin of replication and a selectable marker gene. Although the eukaryotic DNA can be stably replicated in the bacteria, the gene is often not expressed. Explain four possible reasons why this is the case.
ADVERTISEMENT
Subjects
ADVERTISEMENT
Latest Questions
ADVERTISEMENT