If you would do a PCR experiment using the Klenow fragment of the E.coli DNA polymerase...

If you would do a PCR experiment using the Klenow fragment of the E.coli DNA polymerase I instead of Taq DNA polymerase, what would you have to change in the experimental set-up and explain why?

Expert Solution

gladiator answered 3 years ago

The Klenow fragment is produced when DNA polymerase 1 from E.coli is enzymatically cleaved by the...

The Klenow fragment is produced when DNA polymerase 1 from E.coli is enzymatically cleaved by the protease subtilisin. Using diagrams, explain what the Klenow fragment is and why the fragment is better suited for site-directed mutagenesis than intact DNA polymerase 1?

Which DNA polymerase is responsible for the bulk of DNA synthesis in E.coli cells? Which DNA...

Which DNA polymerase is responsible for the bulk of DNA synthesis in E.coli cells? Which DNA polymerase was identified first? Define “processivity”. A. Pol III; Pol I; How long the DNA polymerase complex continues to catalyze chain extension before detachment from DNA B. Pol I; Pol II; The stability of a DNA polymerase molecule in an E. coli cell C. Pol II; Pol I; How many DNA chains the polymerase can synthesize in 60 min D. Pol I; Pol III;...

Explain how PCR (polymerase chain reaction) works. After explaining PCR, compare PCR to the DNA replication...

Explain how PCR (polymerase chain reaction) works. After explaining PCR, compare PCR to the DNA replication that occurs naturally in living cells, making sure to give at least 4 similarities and 4 differences.

what does the polymerase chain reaction (PCR) accomplish? 1) PCR converts RNA to DNA 2) PCR...

what does the polymerase chain reaction (PCR) accomplish? 1) PCR converts RNA to DNA 2) PCR corrects mutation in a gene 3) PCR makes many copies of DNA segment 4) PCR joins short segments of DNA to make one long segment how does the ribosome select the next amino acid to add to a growing polypeptide chain? 1) the ribosome selects the amino acid that can form hydrogen bonds with the mRNA 2) the ribosome selects a tRNA that base-pairs...

How are thermostable DNA Polymerases important for Polymerase Chain Reactions (PCR)?

Experiment 2- Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector “Table 1: Fragment Lengths” “DNA...

Experiment 2- Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector “Table 1: Fragment Lengths” “DNA Type” “Longest Length (in base pairs)” “Foreign” 720 “Plasmid” 2804 1. What is the expected size of the plasmid plus the cut foreign DNA? 2. What type of ends to the enzymes BamHI and EcoRI produce? How does this type of end facilitate cloning? 3. What enzyme is necessary to permanently link the digested foreign and plasmid DNA together to form the recombinant DNA...

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following...

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following questions refer to a PCR reaction designed to amplify the DNA helix below. Region 1 Region 2 5’ GCTAGCTGTGGCTTAATATAGCCCGCAGTAGCGT 3’ b. While mixing up the PCR reaction mix, you accidentally add too little of the concentrated buffer, thus producing a lower than anticipated ion concentration. To compensate, you should (INCREASE/DECREASE/NOT ALTER) the denaturation temperature. Which of the explanations below best supports your answer? A....

E.Coli DNa Pol III consists of a 5'3' polymerase activity and a 3'5' proofreading activity. lets...

E.Coli DNa Pol III consists of a 5'3' polymerase activity and a 3'5' proofreading activity. lets assume that a novel mutation results in a defective DNA Pol III, which can normally Polymerize nucleotides But can't proofread accurately. This error prone polymerase may result in one mistake per 100 base pairs. In order to prevent extensive damage to the genome, the micro must recruit a DNA repair mechanism. The microbe should be able to identify the newly synthesized strand of DNA...

Define and explain their function in a PCR Reaction a) DNA polymerase b) Primers c) dNTPs...

Define and explain their function in a PCR Reaction a) DNA polymerase b) Primers c) dNTPs d) MgCl2 e) DNA

Explain the technology of polymerase chain reaction (PCR) and how it applies to forensic DNA typing

Question