Question

In: Biology

6.- Your friend Silvester wishes to subclone a 1.7 kb DNA fragment into the pCR 2.1...

6.- Your friend Silvester wishes to subclone a 1.7 kb DNA fragment into the pCR 2.1 TOPO plasmid vector. His goal is to amplify the desired fragment by PCR. At the end of the PCR cycling reaction, he immediately adds 4 ?L of PCR reaction, (the maximum of DNA allowable) to the ligation mix. He did the transformation and plated it onto solid media containing the right amount of X-gal and ampicillin.

He picked a single white colony, inoculated it into liquid LB media with ampicillin and grew it up overnight. The next day he purified the plasmid DNA from the colony and sent it for sequencing. He prepared two tubes of DNA, one sample of plasmid will be sequenced using the M13 -20 primer to sequence the bottom strand. The second DNA sample will be sequenced with the M13 Reverse primer to sequence the upper strand. Silvester got the sequence back and the chromatograms were very good. When he BLAST’ed the sequences using NCBI he realized that he had cloned a PCR product that was only 800 bp. He was upset because he felt that since he'd used blue-white selection and chose a white colony that he should have isolated the fragment he was interested in. He is confused and does not understand his results.

(i) Why was Silvester able to conclude with confidence that the PCR product he submitted for sequencing was only 800 bp? (10 pts).

            (ii) Explain why a 800 bp sequence was ligated into the pCR 2.1 TOPO vector although his aim was to amplify a larger PCR product (5 pts).

            (iii) Give him some recommendations that would help to him to select the right clones for sequencing in the future (15 pts).

Solutions

Expert Solution

(i) Ans- NCBI Basic Local Alignment Search Tool (BLAST) recognize the similarity between sequence within the local region. When there is an exact homology between two sequences then the BLAST gives good hits for the query sequence. In the above-mentioned case, Silvester runs BLAST with his PCR product (sequence). While analyzing the BLAST result he probably gets a good hit on a chromosome but the hit length always remain fixed i.e. 800bp. So, Silvester concludes that the length of his PCR product should be 800bp.
(ii) Ans- 800 bp ligation might occur due to the improper restriction digestion and the ratio of the insert and the vector might also be responsible for the inappropriate ligation

fig: Cloning of PCR product by TA overhangs

(iii)-Ans- The ratio of the vector and insert is very crucial for a proper ligation. For sticky end ligation generally 3:1 (insert: vector) ration gives a good result. in case of blunt end ligation the increased insert ratio is recommended. Choosing of the restriction enzyme is also very crucial for a directional cloning.


Related Solutions

A 2 kb fragment of DNA was cut by EcoRI and BamHI and then analyzed by...
A 2 kb fragment of DNA was cut by EcoRI and BamHI and then analyzed by gel electrophoresis. The following fragment sizes were produced: EcoRI: 900, 700, 400 BamHI: 1100, 900 In order to map the location of each restriction site, each fragment was then digested with the other two restriction enzymes. The following was obtained: BamHI-Treated EcoRI-Treated Original Fragment Size 700, 200 - 900 EcoRI 700 - 700 400 - 400 - 700, 400 1100 BamHI - 700, 200...
PCR can be utilized to generate a large quantity of a specific DNA fragment. The following...
PCR can be utilized to generate a large quantity of a specific DNA fragment. The following questions refer to a PCR reaction designed to amplify the DNA helix below. Region 1 Region 2 5’ GCTAGCTGTGGCTTAATATAGCCCGCAGTAGCGT 3’ b. While mixing up the PCR reaction mix, you accidentally add too little of the concentrated buffer, thus producing a lower than anticipated ion concentration. To compensate, you should (INCREASE/DECREASE/NOT ALTER) the denaturation temperature. Which of the explanations below best supports your answer? A....
If you would do a PCR experiment using the Klenow fragment of the E.coli DNA polymerase...
If you would do a PCR experiment using the Klenow fragment of the E.coli DNA polymerase I instead of Taq DNA polymerase, what would you have to change in the experimental set-up and explain why?
Question 1: You set up a 200 µL PCR to amplify a 1-kb fragment by adding...
Question 1: You set up a 200 µL PCR to amplify a 1-kb fragment by adding 20 µL of a 500 nM primer that is 20-bp in length. How many times would you expect to find the exact 20-bp sequence in the human genome (using a genome size of 3.0 E+9 bp) at random? How many moles of the primer have you added? How many molecules of that primer have you added? Describe whether this amount of primer is a...
A Drosophila transgene has coding sequences for GFP positioned downstream of a 7-kb DNA fragment taken...
A Drosophila transgene has coding sequences for GFP positioned downstream of a 7-kb DNA fragment taken from the segment-polarity gene wingless (wg). In Drosophila embryos, the transgene expresses GFP fluorescence in exactly the same pattern as Wg. Crosses are used to place the transgene in different mutant backgrounds. Describe the pattern of GFP fluorescence you expect to see in each of the following types of embryos if they are examined at germ-band extension. i. wild-type ii. embryos laid by a...
Short note for the below: Amplified Fragment Length Polymorphism (AFLP) Human-animal chimaeras NF-kB signaling pathway DNA...
Short note for the below: Amplified Fragment Length Polymorphism (AFLP) Human-animal chimaeras NF-kB signaling pathway DNA aptamers and their applications Riboseitches Structure and fuction of the aryl hydrocarbon receptor (AhR) (in Toxicology) Epignetics of Rett Syndrom Gene-knockout mice and applications
6 a) You and your friend are in a class with 12 students. For a project,...
6 a) You and your friend are in a class with 12 students. For a project, the class is randomly divided into two equal groups. “Randomly” means all divisions are equally likely. What is the probability that you and your friend end up in the same group? 6 b) Revisit part a). Calculate the probability that you and your friend will end up in the same group if the class is divided into three equal groups instead.
2. Your friend wishes to begin saving, but he finds he continually spends the amount he...
2. Your friend wishes to begin saving, but he finds he continually spends the amount he plans to save each month on impulse purchases. a. Would you say your friend is being rational? Why or why not? b. Is there any plan you could suggest to your friend to help him adjust his behaviour to better meet his goals?
Your friend just got a five-year car loan for $40,000 with 6%interest rate (APR) and...
Your friend just got a five-year car loan for $40,000 with 6% interest rate (APR) and monthlypayments. You explained to her that 6% is too high, and she could have saved a lot of money if shenegotiated with the bank and got 3% instead. How much money would your friend have saved everymonth if the rate was 3% instead of 6%?
6. Your friend Sally just returned from a trip to New York where she was very...
6. Your friend Sally just returned from a trip to New York where she was very impressed by a visit to the stock market. Is it correct to say that she visited the stock market? What exactly did Sally visit? Is there more than one place in New York that she might have visited? Explain exactly what the stock market is and how it’s related to what Sally visited 7. Describe the process that occurs when an investor places an...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT