Can DNA be amplified from a degraded sample for PCR?

Expert Solution

Degradation of sample indicates that the DNA present in the sample is broken down to single nucleotides. DNA is degraded in samples by nucleases present in the sample.

Degraded sample can be amplified by PCR only if there is still some amount of intact template present in the sample. Intact template means that these DNA fragments have both the regions that are complementary to the forward and reverse primers. In this case, minimal amplification of the template will occur. The PCR product seen in agarose gel electrophoresis will be reduced significantly. However, if the sample is completely degraded, then no amplification will occur upon PCR.

Amplification of completely degraded sample in PCR will appear as a smear upon agarose gel electrophoresis. If only single stranded cuts are present in the degraded DNA, then smearing may not be observed. In this case, DNA samples need to be denatured before gel electrophoresis to check for degradation.

gladiator answered 2 weeks ago

What are six possible reasons for a PCR not generating an amplified DNA product?

PCR can generate over 100 _______________ copies of DNA in hours. , _, _, and ___...

PCR can generate over 100 _________________ copies of DNA in hours. ____, _____, _____, and _____ are the nucleotides needed to ______ copies of DNA Why do we need to add primers? What can DNA Polymerase withstand that other enzymes cannot? When do your desired fragments start to appear? On cycle ________________, you have over a billion copies of DNA. What is the purpose of the agarose gel? What makes the DNA move? DNA migrates to the _________________ end of...

briefly describe how PCR and gel electrophoresis can be used to analyse DNA samples from crime...

briefly describe how PCR and gel electrophoresis can be used to analyse DNA samples from crime scenes.

As a reminder, PCR is the technique used to replicate DNA in the lab. PCR is...

As a reminder, PCR is the technique used to replicate DNA in the lab. PCR is based on the way DNA is replicated in cells. During PCR template DNA plus other ingredients are placed in a test tube and the solution goes through repeated cycles of heating and cooling. The 'ingredients' of a basic PCR reaction are: DNA template, primer, nucleotides, DNA polymerase, and any salts required for polymerase function (buffer). No ligase is required in PCR but it is...

Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain...

Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain how you went about designing them.

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following...

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following questions refer to a PCR reaction designed to amplify the DNA helix below. Region 1 Region 2 5’ GCTAGCTGTGGCTTAATATAGCCCGCAGTAGCGT 3’ b. While mixing up the PCR reaction mix, you accidentally add too little of the concentrated buffer, thus producing a lower than anticipated ion concentration. To compensate, you should (INCREASE/DECREASE/NOT ALTER) the denaturation temperature. Which of the explanations below best supports your answer? A....

Question

Can DNA be amplified from a degraded sample for PCR?

Solutions

Expert Solution

Related Solutions

What are six possible reasons for a PCR not generating an amplified DNA product?

PCR can generate over 100 _______________ copies of DNA in hours. , _, _, and ___...

briefly describe how PCR and gel electrophoresis can be used to analyse DNA samples from crime...

As a reminder, PCR is the technique used to replicate DNA in the lab. PCR is...

Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain...

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following...

During “cut and paste” cloning, the PCR-amplified gene is cut by restriction enzymes. How does the...

PCR takes advantage of the steps of DNA replication. Match each step of PCR with the...

How can DNA extraction, PCR, and gel electrophoresis be used in forensic science? Explain

Explain how PCR (polymerase chain reaction) works. After explaining PCR, compare PCR to the DNA replication...