Discuss the statement that “DNA isn’t just a sequence of letters; it’s not just a script....

Discuss the statement that “DNA isn’t just a sequence of letters; it’s not just a script. DNA is a dynamic movie in which our experiences are being written.” How does this relate to Gottlieb’s theory of probabilistic epigenesis? 100 or more words essay

Expert Solution

DNA nucleotide (A, T, G, and C) contains all the information that is needed to define human life. According to “central dogma of biology”, DNA is transcribed into RNA and RNA is converted into protein. In this way, DNA through a series of nucleotide is the blueprint of genetic information. But several theories are coming into the picture that state that chromosome activity also influences the gene expression like modification of histone proteins and methylation of DNA. These changes are due to environmental factors. In these condition, DNA sequence is not altered. Epigenetics is the science of study where gene function change, but not due to change in the DNA sequence. It means that sequences of DNA not only responsible for change in gene expression. But some other factors are involved.

According to, Gottlieb’s theory of probabilistic epigenesis, Gottlieb’s state that epigenesis is important factor for the construction in developmental science. Hence, he has given a model where epigenesis to study the gene expression, due to epigenesis.

gladiator answered 1 year ago

A DNA sequence is. TACACCTTGGCGACGACT

A DNA sequence is. TACACCTTGGCGACGACT WHAT IS m RNA sequence is _______________________________ mutated sequence is TACACCTTGGGACGACT what is mRNA mutated. ____________________________________ What kind of mutation is this and what would be the result in terms of the amino acid sequence? (hint... use chart in notes

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAG

Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTACCACACATCAACTGCAACTCCAAAGCCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGAAAACCCTTGACCAACCATCCTCCAGGGCCGAGGGTAATTTCTTTTGGTTTCATTCTAAAGGCACCATTGTGCGACTTTCTATTTGAACTCAAGGGCAGTTTCTTTATTCCTCTCCCTTTACTCTCGCATCCTTAAAGGAAAAGGAGGTTTCGAATTCCCCCCTGTCTAATTGTTAGAGCACACATAGGCGATCGTTCTATAACTCAGCACAAACCGGGGGGAAAAACATTTCATAGGGGCACTAAGTCTCGGATTCCCCATCTTCCCCCGGGGGCTGGGCGGGTAGCCCCTTGAAAACACTAGACCCTTCGGTGGTAAAAATTGCCTACAACCGAATTAAAAAATGAGAGCCGTTTTTCCTGGC Reverse sequence: ATTTTGAGGGGGCTTCTTGGGGGGCGAGTAGGATTGACTCGTGATGTGCTATGTACGGTAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGAGGTGGCTTTGGAGTTGCAGTTGATGTGTGGTAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGGTTTTGATGTTGGATTGGGTTTTTTATGTACTACAGGTGGTTAAGTATTTTATGGTACCGTGCAATTATTTCATGGGTGGCTGGGCAGTATTGTACGGAGATACCATAGCGGGTTGGTTGGATGGGGTAAAGTCATTAATTTGGGGTGGGTACCCCAAATCTGCTTCCCCCATGAAAAGAAACAGAGAATAAGTTTTAATTTTGGTTTCTTTAGCTTTGGGGTGCTTAATGGGGGGGAGGTTAAAAAACCCCCCCGCCGTTTCCCGGGGGGGGGGGGGGGGGCAACCTTCCCCGGGCCCGGGGGGAAAACTAACCCGTATGGACAGTCTTCCAATCACGTCAAAGTTTAGGTCTTTTTATATTACTTCAATGGGGCTGGGGGACGTTCGGGAAAACGGGTGACCCATTGGGGGGTTAATCACCTTGGGGGATAGTCCGGTGGGGGAGCTGGCCCAAGTGCCCAATATCAACGTGGTGACGGGGGGGTGGGGGGGGGGCGGTGGGGTCTCGAAA

A seqstring is a sequence of 18 letters(one of the 26 lowercase letters a-z). How many...

A seqstring is a sequence of 18 letters(one of the 26 lowercase letters a-z). How many seq strings are there where the number of letters between any two occurences of the same letter is at least 2?

If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

13.) Redox chemistry isn’t only for chemists, it’s important in biology as well. Below are two...

13.) Redox chemistry isn’t only for chemists, it’s important in biology as well. Below are two different redox forms of Vitamin C. Oxygen lone pairs are omitted for clarity. a) Identify the oxidation states of the carbons that change oxidation state for both molecules. How many electrons are transferred when these forms interconvert? b) From a redox perspective (ignore acid/base aspects), would H2 or O2 be more likely to change Ascorbic Acid into Dehydroascorbic Acid? Briefly explain your choice.

Subject : Critical Thinking Need a Summary in 200-300 words. Consciousness Isn’t a Mystery. It’s Matter....

Subject : Critical Thinking Need a Summary in 200-300 words. Consciousness Isn’t a Mystery. It’s Matter. https://www.nytimes.com/2016/05/16/opinion/consciousness-isnt-a-mystery-its-matter.html

A. Suppose that the sequence below was the open reading frame of a gene. It’s not the...

A. Suppose that the sequence below was the open reading frame of a gene. It’s not the entire mRNA molecule, just the protein coding sequence and in this case the first three bases is the start codon. The sequence is given as DNA sense strand because DNA is where mutations happen. 5’-ATGTCTAAACTGCGTGAGTAA-3’ i. Give the sequence of the polypeptide it encodes. Make sure to mark the carboxyl and amino terminal ends. ii. Give a mutant version of the second codon that has...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized from the DNA. (Hint: which strand will you use to build your mRNA?) Then write out the amino acid polypeptide that will be synthesized from this sequence and correctly label the 5’ – 3’ directionality of the mRNA and amino acid fragments: Gene: 5’- A T G C T T C A A G T T G G T C C T C C...

Question