Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAG

Compare to this DNA sequence:

1. Forward sequence:

GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTACCACACATCAACTGCAACTCCAAAGCCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGAAAACCCTTGACCAACCATCCTCCAGGGCCGAGGGTAATTTCTTTTGGTTTCATTCTAAAGGCACCATTGTGCGACTTTCTATTTGAACTCAAGGGCAGTTTCTTTATTCCTCTCCCTTTACTCTCGCATCCTTAAAGGAAAAGGAGGTTTCGAATTCCCCCCTGTCTAATTGTTAGAGCACACATAGGCGATCGTTCTATAACTCAGCACAAACCGGGGGGAAAAACATTTCATAGGGGCACTAAGTCTCGGATTCCCCATCTTCCCCCGGGGGCTGGGCGGGTAGCCCCTTGAAAACACTAGACCCTTCGGTGGTAAAAATTGCCTACAACCGAATTAAAAAATGAGAGCCGTTTTTCCTGGC

Reverse sequence:

ATTTTGAGGGGGCTTCTTGGGGGGCGAGTAGGATTGACTCGTGATGTGCTATGTACGGTAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGAGGTGGCTTTGGAGTTGCAGTTGATGTGTGGTAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGGTTTTGATGTTGGATTGGGTTTTTTATGTACTACAGGTGGTTAAGTATTTTATGGTACCGTGCAATTATTTCATGGGTGGCTGGGCAGTATTGTACGGAGATACCATAGCGGGTTGGTTGGATGGGGTAAAGTCATTAATTTGGGGTGGGTACCCCAAATCTGCTTCCCCCATGAAAAGAAACAGAGAATAAGTTTTAATTTTGGTTTCTTTAGCTTTGGGGTGCTTAATGGGGGGGAGGTTAAAAAACCCCCCCGCCGTTTCCCGGGGGGGGGGGGGGGGGCAACCTTCCCCGGGCCCGGGGGGAAAACTAACCCGTATGGACAGTCTTCCAATCACGTCAAAGTTTAGGTCTTTTTATATTACTTCAATGGGGCTGGGGGACGTTCGGGAAAACGGGTGACCCATTGGGGGGTTAATCACCTTGGGGGATAGTCCGGTGGGGGAGCTGGCCCAAGTGCCCAATATCAACGTGGTGACGGGGGGGTGGGGGGGGGGCGGTGGGGTCTCGAAA

Expert Solution

After comparing both of the states, we found

E value- 5e-124

Identities:345/392(88.01%)

gladiator answered 2 years ago

A DNA sequence is. TACACCTTGGCGACGACT

A DNA sequence is. TACACCTTGGCGACGACT WHAT IS m RNA sequence is _______________________________ mutated sequence is TACACCTTGGGACGACT what is mRNA mutated. ____________________________________ What kind of mutation is this and what would be the result in terms of the amino acid sequence? (hint... use chart in notes

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

Suppose the DNA bases in a gene sequence follow the distribution: DNA base Probability A 1/3...

Suppose the DNA bases in a gene sequence follow the distribution: DNA base Probability A 1/3 C θ G 1/3 T 1/3 - θ In an experiment, the number of observed bases that are “A” or “C” in a gene sequence is x, and the number of observed bases that are “G” or “T” is y. The EM method is used to find the best value for the parameter θ. Describe the Expectation step for computing the expected numbers of...

If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

Using the following DNA sequence, come up with your own corresponding sequence after a 1) point...

Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.

A sequence of DNA reads: 5’ TCT GGC AAT CGC TAT 3’ 1.What is the sequence...

A sequence of DNA reads: 5’ TCT GGC AAT CGC TAT 3’ 1.What is the sequence of nucleotides on the complementary strand of DNA? 2.Which strand of DNA serves as the template strand – 5’ to 3’ or 3’ to 5’? 3.List the sequence of codons that result from the transcription of this DNA 4.What is the sequence of amino acids encoded by this DNA (Refer to the chart on the next page)? 5.How would the sequence of amino acids...

Compare MM hedge and forward hedge. Compare forward hedge and futures hedge. Compare options and futures....

Compare MM hedge and forward hedge. Compare forward hedge and futures hedge. Compare options and futures. Which is easier to use? Which is riskier? Which has a higher initial cost?

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of...

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures? 2. Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phosphate. What could be the identify of this lipid? Explain.

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized from the DNA. (Hint: which strand will you use to build your mRNA?) Then write out the amino acid polypeptide that will be synthesized from this sequence and correctly label the 5’ – 3’ directionality of the mRNA and amino acid fragments: Gene: 5’- A T G C T T C A A G T T G G T C C T C C...

Question