Question

In: Biology

1. Mutations within a DNA sequence _____________. Choose all that apply * are natural processes always...

1. Mutations within a DNA sequence _____________.

Choose all that apply * are natural processes

always affect the phenotype. are unnatural processes.

decreases genetic diversity.

increases genetic diversity. never affect phenotype.

2.

A process by which individuals that are better suited to their environment survive and reproduce most successfully best describes: *

acquired characteristics

the bottleneck effect

natural selection

mutations

3.

A biologist analyzes the DNA sequences in three different lizards. The biologist finds that lizards A and B have nearly identical DNA sequences. The DNA sequences in lizard C are significantly different from those of lizard A. From this information, the biologist may infer that : *

Lizards A and B are more closely related to each other than either is to Lizard C.

All three lizards appeared on Earth at about the same time.

Either lizard A or lizard B must be a direct ancestor of lizard C.

Lizard C must have been the ancestor of both lizard A and lizard B.

4.

Light peppered moths were more common in England than dark peppered moths. When factories started to produce pollution in the area, the bark on the trees were stained black. What is the likely outcome from this event? *

The white moths would reproduce more so they don't go extinct.

The white moths would most likely decrease in numbers because they are easier to be seen and caught by birds

The dark moths would decrease in numbers because their homes changed colors.

There would be no change in the moth populations.

5.

Which of these BEST illustrates Natural Selection? *

An organism with favorable genetic variations will tend to survive and breed successfully.

A population monopolizes all of the resources in its habitat, forcing other species to migrate.

A community whose members work together utilizes all existing resources and migratory routes.

The largest organisms in a species receive the only breeding opportunities.

6.

When individuals in one population are unable to breed with individuals in a different population due to geographic isolation, this may lead to: *

speciation

gene flow

bad luck

mutations

7.During their early stages of development, the embryos of reptiles, birds, and mammals look very similar. This suggests that reptiles, birds, and mammals... *

have a common ancestor.

live in the same types of environments.

are no longer undergoing evolution.

have lost their vestigial structures.

8.Possible sources of genetic variation in a gene pool are: Choose all that apply. *

asexual reproduction

sexual reproduction

spontaneous generation

mutation

death

9.Which of the following statements are part of Darwin's theory of Natural Selection? Choose all that apply. *

more individuals are produced than can survive

there is genetic variation among individuals within a population

individuals within a population must compete for resources

individuals protect the weak within a population

10.Different species of frogs mate at different times of the year. This separation, which has caused them to remain separate species is an example of *

Geographic isolation

Genetic isolation

Temporal isolation

Behavioral isolation

11.How does Natural Selection determine which genetic traits are passed on to the next generation? *

Better adapted organisms tend to produce more offspring than "less fit" organisms.

Better adapted organisms tend to have no advantage over "less fit" orgaonisms.

Better adapted orgaisns tend to kill "less fit" organisms.

Better adapted organisms tend to take resources from 'less fit" organisms.

Evolution can best be described as *

a process of change over time.

the formation of fossils.

a process of growth in an organism.

the change in size of body structures through use and disuse

Solutions

Expert Solution

1. Mutations within a DNA sequence:
are natural processes - because of errors
increases genetic diversity - since any one of 3 other base changes are possible

2. A process by which individuals that are better suited to their environment survive and reproduce most successfully best describes: natural selection

3. A biologist analyzes the DNA sequences in three different lizards. The biologist finds that lizards A and B have nearly identical DNA sequences. The DNA sequences in lizard C are significantly different from those of lizard A. From this information, the biologist may infer that: Lizards A and B are more closely related to each other than either is to Lizard C.

4. Light peppered moths were more common in England than dark peppered moths. When factories started to produce pollution in the area, the bark on the trees were stained black. What is the likely outcome from this event The white moths would most likely decrease in numbers because they are easier to be seen and caught by birds


Related Solutions

Question 180 KRAS mutations in pancreatic cancer (choose all that apply): are oncogenic are inactivating mutations...
Question 180 KRAS mutations in pancreatic cancer (choose all that apply): are oncogenic are inactivating mutations typically prevent the hydrolysis of bound GTP are the first to appear during PDAC progression can lead to reduced HIFalpha expression Question 191 Which of the following is an imaging test used to diagnose pancreatic cancer? Choose all that apply. CA19-9 antigen screening Whippel procedure Endoscopic Retrograde Cholangiopancreatography Computed Tomography scanning Question 201 Immune cells can promote tumor cell proliferation via activation of: STAT3...
Q1. Choose all enzymes that participate in the translation processes. ( Select all that apply.) A....
Q1. Choose all enzymes that participate in the translation processes. ( Select all that apply.) A. release factors B.DNA polymerase II C.aminoacyl tRNA synthetases D.large subunit ribozyme E. DNA polymerase I D. DNA polymerase III Q2.  Which of the following is not a disorder caused by the aggregation of misfolded protein? A. Parkinson's Disease B. sickle-cell anemia C. Huntinton's Disease D. Alzheimer's Disease E. alkaptonuria
DNA mutations can occur in a variety of ways. Choose one of the ways that DNA...
DNA mutations can occur in a variety of ways. Choose one of the ways that DNA mutations can occur that you are learning about this week, identify and briefly describe it. Then, choose a genetic mutation (it can be from your textbook, one you are aware of, or one you learn about through your research of this topic), and describe the type of mutation that it involves. Consider if it affects the ability of the organism to produce proteins correctly,...
Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion -...
Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion - insertion - nonsense mutation - substitution - back mutation
Choose two societal benefit to recombinant DNA technology. Select all that apply. 1. engineering genes of...
Choose two societal benefit to recombinant DNA technology. Select all that apply. 1. engineering genes of living organisms to perform new functions 2. curing genetic disorders 3. development of the cure for all known viral infections 4. development of therapeutic proteins such as insulin 5. genetically modified crops with resistance genes inserted Complete the sentences to identify similarities and differences in the secondary structure of a protein and the secondary structure of DNA. Match the words in the left column...
The sequence of nitrogenous bases in an RNA and DNA strand is always written in the...
The sequence of nitrogenous bases in an RNA and DNA strand is always written in the 5? to 3? direction because __________. 1. each strand of RNA or DNA has an unlinked 3? carbon and an unlinked 5? carbon 2. DNA and RNA are synthesized in this direction in cells 3. DNA strands are antiparallel 4. nucleotides are added to the 5? end of the nucleic acid
Almost all cells within an animal contain DNA with the same sequence, yet different cells can...
Almost all cells within an animal contain DNA with the same sequence, yet different cells can have very different properties and gene expression patterns. What are the primary mechanisms that facilitate the existence of distinct cell types in eukaryotes?
DNA mutations lead to genomic and phenotypic variation. Describe processes by which they are generated. Describe...
DNA mutations lead to genomic and phenotypic variation. Describe processes by which they are generated. Describe intracellular genetic mechanisms which could lead to the beneficial mutations in one organism finding their way into other organisms.
List 3 types of mutations in DNA sequence. How does each affect the resulting protein?
List 3 types of mutations in DNA sequence. How does each affect the resulting protein?
Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAG
Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTACCACACATCAACTGCAACTCCAAAGCCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGAAAACCCTTGACCAACCATCCTCCAGGGCCGAGGGTAATTTCTTTTGGTTTCATTCTAAAGGCACCATTGTGCGACTTTCTATTTGAACTCAAGGGCAGTTTCTTTATTCCTCTCCCTTTACTCTCGCATCCTTAAAGGAAAAGGAGGTTTCGAATTCCCCCCTGTCTAATTGTTAGAGCACACATAGGCGATCGTTCTATAACTCAGCACAAACCGGGGGGAAAAACATTTCATAGGGGCACTAAGTCTCGGATTCCCCATCTTCCCCCGGGGGCTGGGCGGGTAGCCCCTTGAAAACACTAGACCCTTCGGTGGTAAAAATTGCCTACAACCGAATTAAAAAATGAGAGCCGTTTTTCCTGGC Reverse sequence: ATTTTGAGGGGGCTTCTTGGGGGGCGAGTAGGATTGACTCGTGATGTGCTATGTACGGTAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGAGGTGGCTTTGGAGTTGCAGTTGATGTGTGGTAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGGTTTTGATGTTGGATTGGGTTTTTTATGTACTACAGGTGGTTAAGTATTTTATGGTACCGTGCAATTATTTCATGGGTGGCTGGGCAGTATTGTACGGAGATACCATAGCGGGTTGGTTGGATGGGGTAAAGTCATTAATTTGGGGTGGGTACCCCAAATCTGCTTCCCCCATGAAAAGAAACAGAGAATAAGTTTTAATTTTGGTTTCTTTAGCTTTGGGGTGCTTAATGGGGGGGAGGTTAAAAAACCCCCCCGCCGTTTCCCGGGGGGGGGGGGGGGGGCAACCTTCCCCGGGCCCGGGGGGAAAACTAACCCGTATGGACAGTCTTCCAATCACGTCAAAGTTTAGGTCTTTTTATATTACTTCAATGGGGCTGGGGGACGTTCGGGAAAACGGGTGACCCATTGGGGGGTTAATCACCTTGGGGGATAGTCCGGTGGGGGAGCTGGCCCAAGTGCCCAATATCAACGTGGTGACGGGGGGGTGGGGGGGGGGCGGTGGGGTCTCGAAA
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT