define the following terms: biotechnology, plasmid, selectalbe marker, multiple cloning site, restriction enzyme, restriction enzyme site,...

define the following terms: biotechnology, plasmid, selectalbe marker, multiple cloning site, restriction enzyme, restriction enzyme site, DNA transformation, annealing

Expert Solution

1. Enhancement and betterment of biological process by techniques and tools known as biotechnology.

2. Plasmid is a extra chromosomal DNA that can replicate independently. Plasmid exits in bacterial cells and also occur in eukaryotes. Size 1-200kb.

3. A gene introduce into a cells specially into a bacterium or to cell in the culture. It confirm a trait suitable for artificial selection it encodes for a protein product these marker gene introduce into the plant genome to express a protein.

4. MCS also called polylinker a short segment of DNA which contain many restrictions site. Restrictions site within mcs are typically unique occuring only once within a given plasmid.

5. Enzyme produce by certain bacteria that cleaves DNA molecule into fragments at or near specific recognition site known as restriction enzyme.

6. R.E. are cleaves on a specific site are known as restriction enzyme sites.

7. DNA transformation is process in which direct uptake and incorporation of exogenous genetic material from its surrounding through cell membrane transfer into the host cell.

8. Annealing is process of repairing of complementry sequence of single stranded DNA or RNA to pair by hydrogen bond to form a double stranded polynucleotides.

gladiator answered 2 years ago

You digest a plasmid with a restriction enzyme that recognizes a single site on the plasmid....

You digest a plasmid with a restriction enzyme that recognizes a single site on the plasmid. When you perform gel electrophoresis on the digestion product, you quickly realize that there are two bands; one at the expected size and one near the well. Which of the following best explains the outcome? a.DNA was trapped in the agarose gel b.Some plasmids were not digested c.The presence of the chromosomal DNA d.The some plasmids ligated together

If cloning of a 0.8 kb DNA segment was performed at the PstI site of plasmid...

If cloning of a 0.8 kb DNA segment was performed at the PstI site of plasmid pBR322 and the E. coli strain HB-101 was transformed with the construct: a) What is the selection criteria for E. Coli transformants with the recombinant plasmid ?: -Ecoli growth in nutrient-rich culture medium____ -Ecoli growth in culture medium rich in nutrients plus ampicillim_____ - Growth of E. coli in a culture medium rich in nutrients plus tetracycline_____ -Ecoli growth in culture medium rich in...

If a circular plasmid is cut one with a restriction enzyme what is the result? how...

If a circular plasmid is cut one with a restriction enzyme what is the result? how do we determine how many times a restriction enzyme cut.

Early gene cloning experiments involved insertion at one restriction site in the vector; for example, the...

Early gene cloning experiments involved insertion at one restriction site in the vector; for example, the insert would have and EcoRI site at each end, and he vector would be opened at an RI site prior to litigation. Under what circumstances would asymmetric cloning be desirable, with the insert having a different site at each end? Please no pictures or handwritten responses - only typed answers.

8. A circular plasmid of 6200 base pairs (bp) with three restriction enzyme sites at 900,...

8. A circular plasmid of 6200 base pairs (bp) with three restriction enzyme sites at 900, 1300, and 4000 bp. You digest this plasmid, then run the digest on a gel. What are the expected DNA fragment sizes? 9. A linear plasmid of 6200 base pairs (bp) with three restriction enzyme sites at 900, 1300, and 4000 bp. You digest this plasmid, then run the digest on a gel. What are the expected DNA fragment sizes? 10. In a random...

Understand the following enzymatic terms: substrate, enzyme, active site, induced fit, enzyme specificity, product, enzyme /...

Understand the following enzymatic terms: substrate, enzyme, active site, induced fit, enzyme specificity, product, enzyme / substrate complex, cofactors and coenzymes

You would like to sequence the genome of this organism. The restriction enzyme cut site for BglII is AGATCT.

A) You would like to sequence the genome of this organism. The restriction enzyme cut site for BglII is AGATCT. You will use it to clone fragments of the genome in order to sequence it. How many times would you expect this enzyme to cut within the chromosome of Andrebacillus wieczorius ? (2) B) You decide to use a modified bacteriophage vector that can accommodate fragments digested with BglII. You use a partial digest on the chromosomal DNA. What...

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site)...

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site) on a plasmid, with the dots (...) on either side representing the continuing DNA on either side of the polylinker .............5' CACTTAAGCCTGCAGCGTTAGCGT 3'......... ..............3' GTGAATTCGGACGTCGCAATCGCA 5'.......... The plasmid is cut with the restriction endonuclease Pst1, which recognizes the following sequence: -------- -- -5' CTGCAG 3' and which cuts between the A and the G nucleotides. A. After cutting the plasmid with Pst1, how many...

What is an advantage of an enzyme with multiple domains each with a different catalytic site?

17. Describe the function of each of the following tools in biotechnology: a. Restriction Enzymes b....

17. Describe the function of each of the following tools in biotechnology: a. Restriction Enzymes b. PCR c. Gel electrophoresis d. CRISPR e. DNA microarrays 18. Describe how cloning is possible (include something about how the genetic code is universal). 19. Why does genomic sequencing require multiple copies of the genome? Describe practical aspects of including sequencing information in health care.

Question