Question

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site) on a plasmid, with the dots (...) on either side representing the continuing DNA on either side of the polylinker

.............5' CACTTAAGCCTGCAGCGTTAGCGT 3'.........
..............3' GTGAATTCGGACGTCGCAATCGCA 5'..........

The plasmid is cut with the restriction endonuclease Pst1, which recognizes the following sequence:

-------- -- -5' CTGCAG 3'

and which cuts between the A and the G nucleotides.

A. After cutting the plasmid with Pst1, how many DNA fragments would be generated?

B. What would be the sequence of the sticky ends? 5'_________3'

C. C. If the sequence was cut by a different restriction enzyme that recognized the same sequence as Pst1 but cut between the T and the G, what would be the sequence of the sticky ends? 5'_________3'

Answer 1

a) Two DNA fragmments will be formed as there is only one multiple cloning site in the given sequence.

b) The 5' to 3' stick end sequence is 5' TGCA 3'. These are the sticky ends as they not partnered up with its corresponding nucleotides. They're are called sticky as they can easily be glued or pasted back with their complementary nucleotides.

c) The 5' to 3' stick end sequence is 5' GC 3'.

Explanation:

Addition of restriction of endonuclease which recognizes -5' CTGCAG 3'- and cleaves between A and G, then the sequence becomes:

.............5' CACTTAAGCCTGCA         GCGTTAGCGT 3'.........

..............3'GTGAATTCGG        ACGTCGCAATCGCA 5'..........

Yellow highlights are the sticky ends.

c) If it cuts between T and G then,

.............5' CACTTAAGCCT           GCAGCGTTAGCGT 3'.........

............3' GTGAATTCGGACG           TCGCAATCGCA 5'.......