Question

In: Biology

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site)...

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site) on a plasmid, with the dots (...) on either side representing the continuing DNA on either side of the polylinker

.............5' CACTTAAGCCTGCAGCGTTAGCGT 3'.........
..............3' GTGAATTCGGACGTCGCAATCGCA 5'..........

The plasmid is cut with the restriction endonuclease Pst1, which recognizes the following sequence:

-------- -- -5' CTGCAG 3'

and which cuts between the A and the G nucleotides.

A. After cutting the plasmid with Pst1, how many DNA fragments would be generated?

B. What would be the sequence of the sticky ends? 5'_________3'

C. C. If the sequence was cut by a different restriction enzyme that recognized the same sequence as Pst1 but cut between the T and the G, what would be the sequence of the sticky ends? 5'_________3'

Expert Solution

a) Two DNA fragmments will be formed as there is only one multiple cloning site in the given sequence.

b) The 5' to 3' stick end sequence is 5' TGCA 3'. These are the sticky ends as they not partnered up with its corresponding nucleotides. They're are called sticky as they can easily be glued or pasted back with their complementary nucleotides.

c) The 5' to 3' stick end sequence is 5' GC 3'.

Explanation:

Addition of restriction of endonuclease which recognizes -5' CTGCAG 3'- and cleaves between A and G, then the sequence becomes:

.............5' CACTTAAGCCTGCA GCGTTAGCGT 3'.........

..............3'GTGAATTCGG ACGTCGCAATCGCA 5'..........

Yellow highlights are the sticky ends.

c) If it cuts between T and G then,

.............5' CACTTAAGCCT GCAGCGTTAGCGT 3'.........

............3' GTGAATTCGGACG TCGCAATCGCA 5'.......

gladiator answered 2 years ago

The sequence below represents the coding DNA strand of the start of a gene, including part...

The sequence below represents the coding DNA strand of the start of a gene, including part of the 5' untranslated region. (5')...TCGGAAGGAGGTAGCGGCAATGGGGAAAAGTATTGCTT...(3') In studying variants of this gene in disease, a nucleotide mutation of A→T was detected in the first base of the third codon. What effect would this mutation have? (When considering your answer, assume standard initiation of translation is numbered as codon 1.) Select one: a. Terminates translation b. No effect c. Disrupts ionic interactions at physiological pH...

If cloning of a 0.8 kb DNA segment was performed at the PstI site of plasmid...

If cloning of a 0.8 kb DNA segment was performed at the PstI site of plasmid pBR322 and the E. coli strain HB-101 was transformed with the construct: a) What is the selection criteria for E. Coli transformants with the recombinant plasmid ?: -Ecoli growth in nutrient-rich culture medium____ -Ecoli growth in culture medium rich in nutrients plus ampicillim_____ - Growth of E. coli in a culture medium rich in nutrients plus tetracycline_____ -Ecoli growth in culture medium rich in...

Multiple Choice: The nucleotide sequence below represents a gene along the length of part of a...

Multiple Choice: The nucleotide sequence below represents a gene along the length of part of a chromosome. Below the DNA is a pool of tRNA’s with their attached amino acids: the three nucleotides represent the anticodon and the number above each anticodon symbolizes a particular amino acid attached to that tRNA. Using your knowledge of the steps involved in how genes code for proteins, determine which of the amino acid (number) sequences below would correspond with the expected polypeptide chain...

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

A promoter is ______. a. a sequence in DNA that brings RNA polymerase near the site...

A promoter is ______. a. a sequence in DNA that brings RNA polymerase near the site for transcription b. one or more eukaryotic proteins that bind to DNA near the start of a gene c. a protein that associates with bacterial RNA polymerase to help it bind to DNA d. a sequence in RNA that promotes the release of RNA polymerase from DNA Which of the following statements best describes the promoter of a protein-coding gene? a. A site where...

define the following terms: biotechnology, plasmid, selectalbe marker, multiple cloning site, restriction enzyme, restriction enzyme site,...

define the following terms: biotechnology, plasmid, selectalbe marker, multiple cloning site, restriction enzyme, restriction enzyme site, DNA transformation, annealing

describe recombinant DNA cloning,

The uptake of the recombinant DNA into bacterial cells during molecular cloning is called transcription replication...

The uptake of the recombinant DNA into bacterial cells during molecular cloning is called transcription replication transformation ligation selection

Nuclear receptors carry a binding site for a signal molecule and for a DNA sequence. How...

Nuclear receptors carry a binding site for a signal molecule and for a DNA sequence. How is it that identical nuclear receptors in different cells can activate different genes when they bind to the same signal molecule?

1.How do reproductive cloning and therapeutic cloning differ? a. The DNA in the nucleus of cells...

1.How do reproductive cloning and therapeutic cloning differ? a. The DNA in the nucleus of cells produced for therapeutic cloning is genetically identical to the donor genome, whereas in cells produced for reproductive cloning it is not. b. Reproductive cloning requires a supply of fertilized donor egg cells, whereas therapeutic cloning requires unfertilized egg cells. c. Therapeutic cloning requires nuclear transplantation, whereas reproductive cloning does not. d. Embryos are placed into foster mothers during reproductive cloning but not during therapeutic...