If cloning of a 0.8 kb DNA segment was performed at the PstI site of plasmid...

If cloning of a 0.8 kb DNA segment was performed at the PstI site of plasmid pBR322 and the E. coli strain HB-101 was transformed with the construct:
a) What is the selection criteria for E. Coli transformants with the recombinant plasmid ?:
-Ecoli growth in nutrient-rich culture medium____
-Ecoli growth in culture medium rich in nutrients plus ampicillim_____
- Growth of E. coli in a culture medium rich in nutrients plus tetracycline_____
-Ecoli growth in culture medium rich in nutrients plus ampicillim and no growth in tetracycline_____
-Ecoli growth in culture medium rich in nutrients plus tetracycline and no growth in ampicillim_____
b) How would it be verified that the selected transformant has the recombinant molecule, if it is known that the cloned DNA segment does not have restriction sites with PstI?

Solutions

Expert Solution

pBR322 is a well-characterized plasmid of 4.36 kb and has antibiotic resistance genes for both Ampicillin and tetracycline resistance. Ampicillin resistance coding region has the recognition sites for Pst I and the tetracycline resistance coding region has the sites for cleavage by EcoR V, BamH I, and Sal I. So, if a gene is cloned into the plasmid using Pst I, the ampicillin resistance gene would be rendered inactive, so the transformed E. coli HB-101cells would not have ampicillin resistance but would have tetracycline resistance. So, the transformed cells would be able to grow on plates having tetracycline alone but would not grow in the presence of ampicillin.

b) Verification for the insert could be done by first isolating the plasmid from the transformed cells, and then digesting the isolated plasmid with PstI enzyme. since both ends of the insert are complementary to PstI cleaved ends of the vector, there would now be two PstI sites on the plasmid containing the insert, one at each end of the insert. So, this digestion with PstI would give two fragments, one of 4.36 kb and another of 0.8 kb, when the digest is run on an agarose gel along with a DNA ladder.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

Experiment 3: Cloning a DNA Fragment into a Bacterially-Derived Plasmid Vector Foregin DNA = 720 Plasmid...

Experiment 3: Cloning a DNA Fragment into a Bacterially-Derived Plasmid Vector Foregin DNA = 720 Plasmid DNA 2804 Post-Lab Questions 1. What is the expected size of the plasmid plus the cut foreign DNA? 2524 base pairs 2. What type of ends do the enzymes BamHI and EcoRI produce? How does this type of end facilitate cloning? 3. What enzyme is necessary to permanently link the digested foreign and plasmid DNA together to form the recombinant DNA molecule? How does...

Experiment 2- Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector “Table 1: Fragment Lengths” “DNA...

Experiment 2- Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector “Table 1: Fragment Lengths” “DNA Type” “Longest Length (in base pairs)” “Foreign” 720 “Plasmid” 2804 1. What is the expected size of the plasmid plus the cut foreign DNA? 2. What type of ends to the enzymes BamHI and EcoRI produce? How does this type of end facilitate cloning? 3. What enzyme is necessary to permanently link the digested foreign and plasmid DNA together to form the recombinant DNA...

Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector” “Table 1: Fragment Lengths” DNA TYPE: LONGEST...

Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector” “Table 1: Fragment Lengths” DNA TYPE: LONGEST LENGTH FOREIGN: 716 PLASMID: 2837 Post-Lab Questions 1. What is the expected size of the plasmid plus the cut foreign DNA? 2. What type of ends to the enzymes BamHI and EcoRI produce? How does this type of end facilitate cloning? 3. What enzyme is necessary to permanently link the digested foreign and plasmid DNA together to form the recombinant DNA molecule? How does...

define the following terms: biotechnology, plasmid, selectalbe marker, multiple cloning site, restriction enzyme, restriction enzyme site,...

define the following terms: biotechnology, plasmid, selectalbe marker, multiple cloning site, restriction enzyme, restriction enzyme site, DNA transformation, annealing

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site)...

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site) on a plasmid, with the dots (...) on either side representing the continuing DNA on either side of the polylinker .............5' CACTTAAGCCTGCAGCGTTAGCGT 3'......... ..............3' GTGAATTCGGACGTCGCAATCGCA 5'.......... The plasmid is cut with the restriction endonuclease Pst1, which recognizes the following sequence: -------- -- -5' CTGCAG 3' and which cuts between the A and the G nucleotides. A. After cutting the plasmid with Pst1, how many...

Experiment 2: Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector Bacteria frequently contain extrachromosomal plasmids,...

Experiment 2: Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector Bacteria frequently contain extrachromosomal plasmids, which are circular DNA genetic elements that are self-replicating. Plasmids are typically not necessary for the bacteria's survival but can sometimes confer a growth advantage to the bacteria. Plasmids can be transferred between bacteria and recombinant DNA technology makes use of this feature to introduce “foreign” genes into bacteria and use the bacteria as a cell “factory” to produce the gene. Genes are inserted...

describe recombinant DNA cloning,

You digest a plasmid with a restriction enzyme that recognizes a single site on the plasmid....

You digest a plasmid with a restriction enzyme that recognizes a single site on the plasmid. When you perform gel electrophoresis on the digestion product, you quickly realize that there are two bands; one at the expected size and one near the well. Which of the following best explains the outcome? a.DNA was trapped in the agarose gel b.Some plasmids were not digested c.The presence of the chromosomal DNA d.The some plasmids ligated together

You've performed a shotgun cloning experiment with your favorite organism and pGEM 7 as the cloning...

You've performed a shotgun cloning experiment with your favorite organism and pGEM 7 as the cloning vecto. After the ligation and transformation, you observe a plate with a mixture of blue and white colonies If you isolated plasmid DNA from blue colonies what would you expect to observe in relation to the presence of an insert? And if you isolated plasmid from white colonies what would you expect to observe in relation to the presence of an insert?

Why is the cloning reaction, transformation reaction, and pouring plates important for sequencing a plasmid? This...

Why is the cloning reaction, transformation reaction, and pouring plates important for sequencing a plasmid? This is a lab-related question. We did cloning, transformation, and poured plates in lab, but why is this important for sequencing a plasmid? Please help me!!!

Subjects