Your supervisor asked you to design a diode that has a total junction capacitance at 0V...

Your supervisor asked you to design a diode that has a total junction capacitance at 0V of 1pF. You are asked to start with an n-type GaAs wafer with a doping of 1x1017 cm-3, then create the p-type layer by doping the substrate with accepters. The substrate manufacturer told you that the GaAs substrate has trap centers equal to 2x1014 cm-3 and capture cross-sections for electrons and holes was of 1.0x10-12 cm2. After designing the diode, you are asked to calculate the following: (a) the saturation current density, (b) the forward current density at 0.9V, (c) the diffusion capacitance/cm2 at 0.9V, and (d) the junction capacitance/cm2 at V=-2V.

Your design must be practical that can be fabricated and used in circuits.

Solutions

Expert Solution

genius_generous answered 1 year ago

Next > < Previous

Related Solutions

In your first assignment on the job, your supervisor has asked you to report on the...

In your first assignment on the job, your supervisor has asked you to report on the company’s competitors future products. You really want to succeed. What do you do? A. You could call the competitors pretending you are a college student working on project needing information B. You could ask a college friend to call the competitors and ask for the information C. You could call the competitors, but would not tell them who you really are unless if asked...

Your supervisor has asked you to explain the value of the fact that you completed this...

Your supervisor has asked you to explain the value of the fact that you completed this accounting course.

Assume that you are a manager in a factory and your supervisor has asked you increase...

Assume that you are a manager in a factory and your supervisor has asked you increase productivity without hiring additional workers or incurring overtime. Describe how you could motivate the existing workers using one content perspective and one process perspective. Support your answer.

Imagine that you work for a state health department. Your supervisor has asked that you review...

Imagine that you work for a state health department. Your supervisor has asked that you review vaccines for an upcoming training session for public health professionals. You will present this information in a professional report. For this report, you will select a vaccine-preventable disease or biological agent and describe the characteristics of a homeostatic system in both health and in a diseased state. Your report should include the pathophysiological impact on the body system affected in disease, how the disease...

Imagine that you work for a state health department. Your supervisor has asked that you review...

Your supervisor has asked you to prepare some calculations based on the company’s data and then...

Your supervisor has asked you to prepare some calculations based on the company’s data and then research publicly available similar competitor information to see how your company is performing within the industry. Your company, CarryIt Inc., produces mass quantity, inexpensive tote bags for promotional marketing purposes, which is a very competitive business. Here is the available data for your company: Labor hours .25; Labor rate $11.75/hour; Materials input .5 yds. fabric; Materials price $1.50/yd.; and Variable overhead rate of $5.00...

A Si pn diode has an equilibrium diffusion barrier of 0.7 V and an area capacitance...

A Si pn diode has an equilibrium diffusion barrier of 0.7 V and an area capacitance of C2D = 4 nF/cm2 for a reverse bias voltage of -4.3 V. What can you tell about the doping levels?

1. ⦁ Your supervisor has asked you to desine PCR primers to amplify the following region...

1. ⦁ Your supervisor has asked you to desine PCR primers to amplify the following region in the human genome. 5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT GGATGCTTGCATTACCAAGGCAAGCT -3’ Here is the sequence for the forward/right primer. 5’- CGTTCGTAATCTTGGTGAATTAAT-3’ a) Was this primer designed to bind the DNA strand given above or the complementary strand? Hint: you may want to write out the complementary sequence to this DNA sequence to help you answer this question. b) Underline the bases where this...

Suppose you are an investment analyst, your supervisor, a portfolio manager asked you to write a...

Suppose you are an investment analyst, your supervisor, a portfolio manager asked you to write a brief report on how will the COVID-19 outbreak affect the stock market and economy in the world and Malaysia, and the report must include detailed analysis from part (1) to part (3) below. Perform a fundamental analysis of the overall market and economy in Malaysia. How will COVID-19 outbreaks across the world affect the Malaysian economy in terms of economic growth rate in 2021?...

You have recently joined Royal Security Services as an information security intern. Your supervisor has asked...

You have recently joined Royal Security Services as an information security intern. Your supervisor has asked you to research two network firewalls. In this regard, you have to create a table by comparing features of firewalls in terms of filtering methods (stateless or stateful filtering), additional features these firewalls support (IDS, content filtering, etc.), and the cost of each firewall. Which one you would recommend to your supervisor? Justify your answer. please give answer in tabular form

Subjects