Question
In: Physics
Your supervisor asked you to design a diode that has a total junction capacitance at 0V...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V of 1pF. You are asked to start with an n-type GaAs wafer with a doping of 1x1017 cm-3, then create the p-type layer by doping the substrate with accepters. The substrate manufacturer told you that the GaAs substrate has trap centers equal to 2x1014 cm-3 and capture cross-sections for electrons and holes was of 1.0x10-12 cm2. After designing the diode, you are asked to calculate the following: (a) the saturation current density, (b) the forward current density at 0.9V, (c) the diffusion capacitance/cm2 at 0.9V, and (d) the junction capacitance/cm2 at V=-2V.
Your design must be practical that can be fabricated and used in
circuits.
Solutions
genius_generous answered 2 years agoRelated Solutions
In your first assignment on the job, your supervisor has asked you to report on the...
In your first assignment on the job, your supervisor has asked
you to report on the company’s competitors future products. You
really want to succeed. What do you do?
A. You could call the competitors pretending you are a college
student working on project needing information
B. You could ask a college friend to call the competitors and
ask for the information
C. You could call the competitors, but would not tell them who
you really are unless if asked...
Your supervisor has asked you to explain the value of the fact that you completed this...
Your supervisor has asked you to explain the value of the fact
that you completed this accounting course.
Assume that you are a manager in a factory and your supervisor has asked you increase...
Assume that you are a manager in a factory and your supervisor
has asked you increase productivity without hiring additional
workers or incurring overtime. Describe how you could motivate the
existing workers using one content perspective and one process
perspective. Support your answer.
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your
supervisor has asked that you review vaccines for an upcoming
training session for public health professionals. You will present
this information in a professional report. For this report, you
will select a vaccine-preventable disease or biological agent and
describe the characteristics of a homeostatic system in both health
and in a diseased state. Your report should include the
pathophysiological impact on the body system affected in disease,
how the disease...
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your
supervisor has asked that you review vaccines for an upcoming
training session for public health professionals. You will present
this information in a professional report. For this report, you
will select a vaccine-preventable disease or biological agent and
describe the characteristics of a homeostatic system in both health
and in a diseased state. Your report should include the
pathophysiological impact on the body system affected in disease,
how the disease...
Your supervisor has asked you to prepare some calculations based on the company’s data and then...
Your supervisor has asked you to prepare some calculations based
on the company’s data and then research publicly available similar
competitor information to see how your company is performing within
the industry. Your company, CarryIt Inc., produces mass quantity,
inexpensive tote bags for promotional marketing purposes, which is
a very competitive business.
Here is the available data for your company:
Labor hours .25;
Labor rate $11.75/hour;
Materials input .5 yds. fabric;
Materials price $1.50/yd.; and
Variable overhead rate of $5.00...
A Si pn diode has an equilibrium diffusion barrier of 0.7 V and an area capacitance...
A Si pn diode has an equilibrium diffusion barrier of 0.7 V and
an area capacitance of C2D = 4 nF/cm2 for a reverse bias voltage of
-4.3 V. What can you tell about the doping levels?
1. ⦁ Your supervisor has asked you to desine PCR primers to amplify the following region...
1. ⦁ Your supervisor has asked you to desine PCR
primers to amplify the following region in the human genome.
5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA
GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC
TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC
TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG
AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT
GGATGCTTGCATTACCAAGGCAAGCT -3’
Here is the sequence for the forward/right primer. 5’-
CGTTCGTAATCTTGGTGAATTAAT-3’
a) Was this primer designed to bind the DNA strand given above
or the complementary strand? Hint: you may want to write out the
complementary sequence to this DNA sequence to help you answer this
question.
b) Underline the bases where this...
Suppose you are an investment analyst, your supervisor, a portfolio manager asked you to write a...
Suppose you are an investment analyst, your supervisor, a
portfolio manager asked you to write a brief report on how will the
COVID-19 outbreak affect the stock market and economy in the world
and Malaysia, and the report must include detailed
analysis from part (1) to part (3) below.
Perform a fundamental analysis of the overall market and
economy in Malaysia. How will COVID-19 outbreaks across
the world affect the Malaysian economy in terms of economic growth
rate in 2021?...
You have recently joined Royal Security Services as an information security intern. Your supervisor has asked...
You have recently joined Royal Security Services as an
information security intern. Your supervisor has asked you to
research two network firewalls. In this regard, you have to create
a table by comparing features of firewalls in terms of filtering
methods (stateless or stateful filtering), additional features
these firewalls support (IDS, content filtering, etc.), and the
cost of each firewall. Which one you would recommend to your
supervisor? Justify your answer.
please give answer in tabular form
ADVERTISEMENT
ADVERTISEMENT
Latest Questions
- Computer Networks IT 210 Please Use your own words . sorry No handwriting no copy paste...
- I would like to integrate a bubble sort into this binary search in c ++ Thank...
- Answer the bottom in 1-2 paragraphs Classical conditioning is a learned behavior where previously neutral response...
- identify one intrapersonal relationship and evaluate its component.
- Using Python in vs code: The distribution of letters in a document has a distinctive and...
- Why is De Beers exploring the diamond reselling market? How does the creation of IIDV affect...
- programming in Python The body mass index (BMI) is calculated as a person’s weight (in lb)...
ADVERTISEMENT