Question

In: Accounting

Your supervisor has asked you to prepare some calculations based on the company’s data and then...

Your supervisor has asked you to prepare some calculations based on the company’s data and then research publicly available similar competitor information to see how your company is performing within the industry. Your company, CarryIt Inc., produces mass quantity, inexpensive tote bags for promotional marketing purposes, which is a very competitive business.

Here is the available data for your company:

  • Labor hours .25;
  • Labor rate $11.75/hour;
  • Materials input .5 yds. fabric;
  • Materials price $1.50/yd.; and
  • Variable overhead rate of $5.00 per direct labor hour.

You are also able to find an industry profile report via a Dun & Bradstreet database that has selected data from a few other companies in similar businesses as well as some industry statistics.

Here’s the data available:

Unit Variable Cost Item Star Company GoldBag Corporation PromoTotes LLC Industry Data
Labor hours .35 .20 .30 .30
Labor rate $11.25 $11.95 $12.50 $11.65
Materials input .45 yds. .675 yds. .50 yds. .55 yds.
Materials price $1.65/yd. $1.35/yd. $1.55/yd. $1.50/yd.
Variable OH rate $6.00 per direct labor hour $5.25 per direct labor hour $4.70 per direct labor hour $5.45 per direct labor hour

In Microsoft Excel, compute the following measures:

  1. Total variable cost per unit for CarryIt, the competitors, and the industry average.
  2. What is the percentage of the total for each component (materials, labor, and variable overhead)?
  3. Assume industry data is your benchmark. What are the price and efficiency variances for direct materials and direct labor for each company?
  4. What is the percentage over standard by company and by variance?

Write your observations about how CarryIt’s performance stacks up to its competition from the benchmarking exercise, Include suggestions for areas of improvement and comments on areas where the company does well.

Solutions

Expert Solution

1. The below information is provided per company and for the industry

Information
Item Carryit Inc Star Comp Gold Bag Promotes Industry
Labour hours reqd per unit       0.2500        0.3500     0.2000      0.3000     0.3000
Labour rate per hour    11.7500      11.2500 11.9500    12.5000 11.6500
Material input required per unit - yards       0.5000        0.4500     0.6750      0.5000     0.5500
Material Price per yard       1.5000        1.6500     1.3500      1.5500     1.5000
Variable overhead rate per labour hour       5.0000        6.0000     5.2500      4.7000     5.4500

2. Basis the above, variable cost per unit is derive as per the formula mentioned

Variable cost per unit
Particulars Carryit Inc Star Comp Gold Bag Promotes Industry
Labour cost for 1 unit = labour hours/unit x rate per hour       2.9375        3.9375     2.3900      3.7500     3.4950
Material cost for 1 unit = Yards per unit x cost per yard       0.7500        0.7425     0.9113      0.7750     0.8250
Variable OH cost = variable OH rate hour hour x labour hours required for 1 unit       1.2500        2.1000     1.0500      1.4100     1.6350
Total Variable Cost       4.9375        6.7800     4.3513      5.9350     5.9550

3. Percentage of the total for each component (materials, labor, and variable overhead)

% on Variable Cost

Particulars

Carryit Inc

Star Comp

Gold Bag

Promotes

Industry

Labour Cost = Labour cost/ Total Variable Cost

59%

58%

55%

63%

59%

Material Cost = Material cost/ Total Variable Cost

15%

11%

21%

13%

14%

Variable OH Cost = Variable cost/ Total Variable Cost

25%

31%

24%

24%

27%

4. What are the price and efficiency variances for direct materials and direct labor for each company compared to Industry

Variance - negative = favourable, positive= unfavourtable
Particulars Carryit Inc Star Comp Gold Bag Promotes
Labour Price Variance => Actual hours reqd x (Actual rate /hour - Industry rate/hour)       0.0250      (0.1400)     0.0600      0.2550
Labour Effeciency Variance => (Actual labour hours reqd per unit - Industry labour hour reqd per unit ) x industry labour rate / hour     (0.5825)        0.5825 (1.1650)               -  
Labour Cost Variance     (0.5575)        0.4425 (1.1050)      0.2550
Material Price Variance => Actual yards reqd x (Actual rate /yd - Industry rate/yd)               -          0.0675 (0.1013)      0.0250
Material Effeciency Variance => (Actual yards reqd per unit - Industry yards reqd per unit ) x industry rate per yard     (0.0750)      (0.1500)     0.1875    (0.0750)
Material Cost Variance     (0.0750)      (0.0825)     0.0863    (0.0500)

5. Percentage over standard by company and by variance?

Particulars Carryit Inc Star Comp Gold Bag Promotes
Labour Cost = (Actual Lab cost- Industry Labour cost)/ Ind Labour Cost -15.95% 12.66% -31.62% 7.30%
Material Cost (Actual Mat cost- Industry Mat cost)/ Ind Mat Cost -9.09% -10.00% 10.45% -6.06%
Variable OH Cost=  (Actual Var OH cost- Industry Var OH cost)/ Ind Var OH Cost -23.55% 28.44% -35.78% -13.76%
Total Variable Cost -17.09% 13.85% -26.93% -0.34%

6. Observations

a. The variable cost per unit for Carryis lesser than industry benchmark across each Labour, Material and Variable Overhead which is good.

b. However on overall basis, Goldbag has the least variable cost with lesser labour cost and variable overhead cost.

c. Basis Goldbag benchmark, company can identify areas for improvement in labour cost and variable over head cost and aim for making the varibale cost per unit the least in the sector.

d. The material cost is also lesser per unit for Star Comp. This can also be taken as a benchmark to reduce Carryit material cost.


Related Solutions

In your first assignment on the job, your supervisor has asked you to report on the...
In your first assignment on the job, your supervisor has asked you to report on the company’s competitors future products. You really want to succeed. What do you do? A. You could call the competitors pretending you are a college student working on project needing information B. You could ask a college friend to call the competitors and ask for the information C. You could call the competitors, but would not tell them who you really are unless if asked...
Your supervisor has asked you to explain the value of the fact that you completed this...
Your supervisor has asked you to explain the value of the fact that you completed this accounting course.
Assume that you are a manager in a factory and your supervisor has asked you increase...
Assume that you are a manager in a factory and your supervisor has asked you increase productivity without hiring additional workers or incurring overtime. Describe how you could motivate the existing workers using one content perspective and one process perspective. Support your answer.
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your supervisor has asked that you review vaccines for an upcoming training session for public health professionals. You will present this information in a professional report. For this report, you will select a vaccine-preventable disease or biological agent and describe the characteristics of a homeostatic system in both health and in a diseased state. Your report should include the pathophysiological impact on the body system affected in disease, how the disease...
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your supervisor has asked that you review vaccines for an upcoming training session for public health professionals. You will present this information in a professional report. For this report, you will select a vaccine-preventable disease or biological agent and describe the characteristics of a homeostatic system in both health and in a diseased state. Your report should include the pathophysiological impact on the body system affected in disease, how the disease...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V of 1pF. You are asked to start with an n-type GaAs wafer with a doping of 1x1017 cm-3, then create the p-type layer by doping the substrate with accepters. The substrate manufacturer told you that the GaAs substrate has trap centers equal to 2x1014 cm-3 and capture cross-sections for electrons and holes was of 1.0x10-12 cm2. After designing the diode, you are asked to...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region in the human genome. 5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT GGATGCTTGCATTACCAAGGCAAGCT -3’ Here is the sequence for the forward/right primer. 5’- CGTTCGTAATCTTGGTGAATTAAT-3’ a) Was this primer designed to bind the DNA strand given above or the complementary strand? Hint: you may want to write out the complementary sequence to this DNA sequence to help you answer this question. b) Underline the bases where this...
Your supervisor, Janine Beauregard, has requested you prepare a memo explaining what a Record of Employment...
Your supervisor, Janine Beauregard, has requested you prepare a memo explaining what a Record of Employment is, the importance of the form, and the importance of completing the form accurately. She is going to use the information you provide in a meeting with the payroll professionals to reinforce the importance of completing accurate Record of Employment forms.
Suppose you are an investment analyst, your supervisor, a portfolio manager asked you to write a...
Suppose you are an investment analyst, your supervisor, a portfolio manager asked you to write a brief report on how will the COVID-19 outbreak affect the stock market and economy in the world and Malaysia, and the report must include detailed analysis from part (1) to part (3) below. Perform a fundamental analysis of the overall market and economy in Malaysia. How will COVID-19 outbreaks across the world affect the Malaysian economy in terms of economic growth rate in 2021?...
You have just passed ACST1001 and started a summer internship at Harrison Bank, with Peter as your supervisor. As your first task, Peter has given you some client accounts and asked you to verify some of the details.
You have just passed ACST1001 and started a summer internship at Harrison Bank, with Peter as your supervisor. As your first task, Peter has given you some client accounts and asked you to verify some of the details.The first file is for a client named Mary, who has a mortgage with the bank. You go through the file and note the following information for Mary's mortgageInitial loan: $640,000Term of loan: 25 yearsRepayment frequency. End of each fortnightInterest rate on loan:...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT