Question

In: Accounting

Your supervisor has asked you to explain the value of the fact that you completed this...

  1. Your supervisor has asked you to explain the value of the fact that you completed this accounting course.

Solutions

Expert Solution

Managers recognize accounting as the language of business. Accounting is a means of providing information about an organization’s financial performance. The role of accounting is not just limited to the business world alone. Governments, churches and other social organizations use accounting for accountability and transparency purposes. Users of accounting information employ it to make numerous investment and financing decisions. Such users include creditors, suppliers, investment analysts, media and government entities

Accounting is a great course to study for a number of reasons. Accounting provides you with skills and knowledge that can be applied to a number of industries. In fact, so long as there are businesses in the world, accountants will always be needed.

A qualification in accounting is the best way kick-start your career, however, before you decide to start studying, it’s worth noting the key benefits a career in accounting can give you.

What do accountants do?
There are many qualifications and jobs that deal with money, so how exactly does accounting differ from other types of finance-related roles? Perhaps the easiest way to describe it is that accounting involves dealing with real revenues, actual transactions and observable finance.

Accountants deal in the reality. They don’t (or shouldn’t) speculate. Accountants know the rules and follow them, and are good at keeping track of figures. They might make assessments based on information in front of them, but they deal less with the unknown than say, a finance-related position.

The primary role of accountants is to prepare and examine financial records. Accountants ensure the accuracy of a person’s or business’s financial records, and that bills and taxes are paid properly and on time. A job as an accountant may also involve the following:

Organise financial records
Review statements for accuracy
Make certain that records and statements comply with the law
Compute taxes owed, prepare tax returns, ensure prompt payment
Inspect account books and accounting systems to keep up to date
Suggest ways to reduce overheads and increase revenues and profits
Provide auditing services
Accountancy as a good foundation
Even if you did want to branch out into finance and economics, a background in accountancy lays the valuable groundwork for developing broader monetary theories. Accountants can hone their craft through the application of known methodologies.

An accountancy certification is always valuable. You’ll learn how to focus on money management, financial recording and reporting, and the best processes to save cash for a business or sole traders. These skills are desired in every industry. For most accountants, it’s never hard to find work.

What is studying accounting like?
The most common course to study for a career in accounting is a Diploma of Accounting.

When studying accounting you will acquire knowledge about the laws that govern business, typical business administration schemes, the ethics of accountancy, statistics, and accounting theory. You’ll be taught how to prepare the key documents that your job will involve, including business proposals, financial statements and tax returns.

You will also have subjects that overlap with other finance-based courses. You will cover areas such as quantitative analytics and mathematics – studying accounting means knowing your way around maths and inferring results from numbers.

Is accounting right for you?
While the course guide can tell you a lot about whether you should study something, it’s also important to consider your future working life and your ideal career.

Do you love routines, problem solving and concrete data? Accounting could be right up your alley. However, if you like a role that is constantly shifting and requires more speculation and risk taking, you may want to try other financial roles.

Still not sure? Don’t stress
It’s normal to not have your future career entirely figured out. There are lots of people whose job it is to help talk you through these decisions. If you can’t quite decide if a Diploma of Accounting is right for you, you can always talk to a student adviser or the head of the department at the educational institute you want to study at. That way, you can get some advice from people who have a thorough understanding of the course and industry.

You should also remember that pursuing one course is not necessarily going to cut you off in a career in the other sector, and it certainly won’t stop you from studying something else in the future if you change your mind.

You can’t really go wrong with a Diploma of Accounting. Even if you decide to switch careers later, you’ll have a great foundational understanding of how money is recorded and reported that will only help you in the long term.

At the very least, you’ll know how to manage your own finances better.

Accounting has good job prospects
If you decide to study a Diploma of Accounting, you probably won’t have to wait long to start working. Jobs in accounting are always in demand and the skills you learn through studying are transferable and can be applied to many other disciplines.


Related Solutions

In your first assignment on the job, your supervisor has asked you to report on the...
In your first assignment on the job, your supervisor has asked you to report on the company’s competitors future products. You really want to succeed. What do you do? A. You could call the competitors pretending you are a college student working on project needing information B. You could ask a college friend to call the competitors and ask for the information C. You could call the competitors, but would not tell them who you really are unless if asked...
Assume that you are a manager in a factory and your supervisor has asked you increase...
Assume that you are a manager in a factory and your supervisor has asked you increase productivity without hiring additional workers or incurring overtime. Describe how you could motivate the existing workers using one content perspective and one process perspective. Support your answer.
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your supervisor has asked that you review vaccines for an upcoming training session for public health professionals. You will present this information in a professional report. For this report, you will select a vaccine-preventable disease or biological agent and describe the characteristics of a homeostatic system in both health and in a diseased state. Your report should include the pathophysiological impact on the body system affected in disease, how the disease...
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your supervisor has asked that you review vaccines for an upcoming training session for public health professionals. You will present this information in a professional report. For this report, you will select a vaccine-preventable disease or biological agent and describe the characteristics of a homeostatic system in both health and in a diseased state. Your report should include the pathophysiological impact on the body system affected in disease, how the disease...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V of 1pF. You are asked to start with an n-type GaAs wafer with a doping of 1x1017 cm-3, then create the p-type layer by doping the substrate with accepters. The substrate manufacturer told you that the GaAs substrate has trap centers equal to 2x1014 cm-3 and capture cross-sections for electrons and holes was of 1.0x10-12 cm2. After designing the diode, you are asked to...
Your supervisor has asked you to prepare some calculations based on the company’s data and then...
Your supervisor has asked you to prepare some calculations based on the company’s data and then research publicly available similar competitor information to see how your company is performing within the industry. Your company, CarryIt Inc., produces mass quantity, inexpensive tote bags for promotional marketing purposes, which is a very competitive business. Here is the available data for your company: Labor hours .25; Labor rate $11.75/hour; Materials input .5 yds. fabric; Materials price $1.50/yd.; and Variable overhead rate of $5.00...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region in the human genome. 5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT GGATGCTTGCATTACCAAGGCAAGCT -3’ Here is the sequence for the forward/right primer. 5’- CGTTCGTAATCTTGGTGAATTAAT-3’ a) Was this primer designed to bind the DNA strand given above or the complementary strand? Hint: you may want to write out the complementary sequence to this DNA sequence to help you answer this question. b) Underline the bases where this...
Suppose you are an investment analyst, your supervisor, a portfolio manager asked you to write a...
Suppose you are an investment analyst, your supervisor, a portfolio manager asked you to write a brief report on how will the COVID-19 outbreak affect the stock market and economy in the world and Malaysia, and the report must include detailed analysis from part (1) to part (3) below. Perform a fundamental analysis of the overall market and economy in Malaysia. How will COVID-19 outbreaks across the world affect the Malaysian economy in terms of economic growth rate in 2021?...
You have recently joined Royal Security Services as an information security intern. Your supervisor has asked...
You have recently joined Royal Security Services as an information security intern. Your supervisor has asked you to research two network firewalls. In this regard, you have to create a table by comparing features of firewalls in terms of filtering methods (stateless or stateful filtering), additional features these firewalls support (IDS, content filtering, etc.), and the cost of each firewall. Which one you would recommend to your supervisor? Justify your answer. please give answer in tabular form
you were asked by your supervisor, "how will you teach students to learn what you don't...
you were asked by your supervisor, "how will you teach students to learn what you don't know"? how will you respond?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT