Question

In: Operations Management

Assume that you are a manager in a factory and your supervisor has asked you increase...

Assume that you are a manager in a factory and your supervisor has asked you increase productivity without hiring additional workers or incurring overtime. Describe how you could motivate the existing workers using one content perspective and one process perspective. Support your answer.

Solutions

Expert Solution

I could motivate the existing workers using the content perspective with many different theories of needs. Among them we will discuss only one, i.e., Maslow's Hierarchy of needs.


According to Maslow's hierarchy of needs people must satisfy five groups of needs, i.e., physiological, security, belonging, esteem and self-actualization. A person's productivity can be increased when all his needs are satisfied. The first one, is physiological need, it means basic needs like, food, clothing, shelter and air to breathe must be met. Managers provide new employees a basic salary, which is essential to satisfy the food needs of workers.


Second is security, it means having a roof over your head and clothing for your body. It also consists of having a pension plan to secure worker's future. When workers feel secured about their job, it can encourage them to increase their productivity.


The third need of hierarchy is belonging which describes the need for love and acceptance. When workers feel that they have friends around them who love them, care for them and they are accepted by their friends, they feel motivated to work and increase productivity.


The fourth level in the hierarcy of need is esteem, it consists of self-image and self-respect. When workers reach a level in their job, they feel pride for them and their jobs. This helps them to boost their productivity level.


The last step in Maslow's pyramid is self-actualization, it is the point where everbody wants to reach. At this point, one should know himself, his strength and accept himself what he is. In this way, he can raise his confidence level and increase his productivity.

Process Perspective:


Expectancy Theory: According to expectancy theory motivation depends on two factors, one is how much we want a particular thing and another is how likely we think we are to achieve it. For example, an employee who is working good and behaving well expects that he must get an increment in his salary. This is expectancy theory. If the employee's expectancy is met, that is, he is provided with a hike in salary then it will raise his motivation level. So as a manager, I could motivate them by paying a higher salary.


Effort-to-Performance Expectancy: It says that whatever effort we put into a task, we get that type of result. If employees are putting their highest effort then they will get the highest outcome. They need to be encouraged in that way which makes them to put their maximum effort on their task, so that they will get best results.


Performance-to-Outcome Expectancy : This says that performance will give you a specific result. This is different from the effort-to-performance, in the sense that you need to hope that things will go in your side even if you didn't act. For example, if an employee will not work hard and expect that he will get a good salary and a good position. The manager should encourage the employees by showing them the real truth of life. As a manager, I would make them realize that nothing can be obtained without a good performance.


Outcomes and Valences: Outcomes are the results of behaviors in an organization, usually rewards, whereas valences are an index of how much an individual expects a particular outcome. Employees should be encouraged to behave well and increase their effort level so that they can expect a better result.



Related Solutions

Suppose you are an investment analyst, your supervisor, a portfolio manager asked you to write a...
Suppose you are an investment analyst, your supervisor, a portfolio manager asked you to write a brief report on how will the COVID-19 outbreak affect the stock market and economy in the world and Malaysia, and the report must include detailed analysis from part (1) to part (3) below. Perform a fundamental analysis of the overall market and economy in Malaysia. How will COVID-19 outbreaks across the world affect the Malaysian economy in terms of economic growth rate in 2021?...
In your first assignment on the job, your supervisor has asked you to report on the...
In your first assignment on the job, your supervisor has asked you to report on the company’s competitors future products. You really want to succeed. What do you do? A. You could call the competitors pretending you are a college student working on project needing information B. You could ask a college friend to call the competitors and ask for the information C. You could call the competitors, but would not tell them who you really are unless if asked...
Your supervisor has asked you to explain the value of the fact that you completed this...
Your supervisor has asked you to explain the value of the fact that you completed this accounting course.
Assume that you are a manager and your boss asked to meet with you later today...
Assume that you are a manager and your boss asked to meet with you later today to discuss putting a team together. Since you were not provided with any other information, you need to be prepared with a written document. Identify the different options for groups and teams, indicate when each type is appropriate, and include some of the characteristics of groups and teams. Also describe the stages of formation. Also, include some of the characteristics of groups and teams.
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your supervisor has asked that you review vaccines for an upcoming training session for public health professionals. You will present this information in a professional report. For this report, you will select a vaccine-preventable disease or biological agent and describe the characteristics of a homeostatic system in both health and in a diseased state. Your report should include the pathophysiological impact on the body system affected in disease, how the disease...
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your supervisor has asked that you review vaccines for an upcoming training session for public health professionals. You will present this information in a professional report. For this report, you will select a vaccine-preventable disease or biological agent and describe the characteristics of a homeostatic system in both health and in a diseased state. Your report should include the pathophysiological impact on the body system affected in disease, how the disease...
Assume you are the accounting manager of Kitten Ltd. being asked from your senior manager to...
Assume you are the accounting manager of Kitten Ltd. being asked from your senior manager to prepare inventory records and compute the closing value of inventory, cost of manufacturing, and cost of goods sold to be reported in the Financial Statements. Following are the inventory related activities that were performed during the period. 1 Purchased 960 units @ 56 per unit 2 Purchased 420 units @54 per unit 3 Issued 280 units to the manufacturing department 4 Manufacturing department worked...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V of 1pF. You are asked to start with an n-type GaAs wafer with a doping of 1x1017 cm-3, then create the p-type layer by doping the substrate with accepters. The substrate manufacturer told you that the GaAs substrate has trap centers equal to 2x1014 cm-3 and capture cross-sections for electrons and holes was of 1.0x10-12 cm2. After designing the diode, you are asked to...
Your supervisor has asked you to prepare some calculations based on the company’s data and then...
Your supervisor has asked you to prepare some calculations based on the company’s data and then research publicly available similar competitor information to see how your company is performing within the industry. Your company, CarryIt Inc., produces mass quantity, inexpensive tote bags for promotional marketing purposes, which is a very competitive business. Here is the available data for your company: Labor hours .25; Labor rate $11.75/hour; Materials input .5 yds. fabric; Materials price $1.50/yd.; and Variable overhead rate of $5.00...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region in the human genome. 5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT GGATGCTTGCATTACCAAGGCAAGCT -3’ Here is the sequence for the forward/right primer. 5’- CGTTCGTAATCTTGGTGAATTAAT-3’ a) Was this primer designed to bind the DNA strand given above or the complementary strand? Hint: you may want to write out the complementary sequence to this DNA sequence to help you answer this question. b) Underline the bases where this...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT