Question
In: Civil Engineering
In your first assignment on the job, your supervisor has asked you to report on the...
In your first assignment on the job, your supervisor has asked you to report on the company’s competitors future products. You really want to succeed. What do you do?
A. You could call the competitors pretending you are a college student working on project needing information
B. You could ask a college friend to call the competitors and ask for the information
C. You could call the competitors, but would not tell them who you really are unless if asked
D. You could call the competitors, explaining from the beginning who you really are, and ask for information
Solutions
Expert Solution
Solution)
In your first assignment on the job, your supervisor has asked you to report on the company’s competitors future products. You really want to succeed. What do you do?
D. You could call the competitors, explaining from the beginning who you really are, and ask for information
As in this situation it is the most ethical on your part and other competitior may give the types of products they are working on rather than th details and specifications of the product. On the other hand if you pretend to be college student take help from your friend then it will pretend that you are cheating the competitor and may competitor will not give the details of the product and you will not get the details Thus it is the best choice to simply ask the complete details about the product and by giving your full details and your task assigned this will help you surely and competitor will give you detail about the future products
Ally Wells answered 8 months agoRelated Solutions
Your supervisor has asked you to explain the value of the fact that you completed this...
Your supervisor has asked you to explain the value of the fact
that you completed this accounting course.
Assume that you are a manager in a factory and your supervisor has asked you increase...
Assume that you are a manager in a factory and your supervisor
has asked you increase productivity without hiring additional
workers or incurring overtime. Describe how you could motivate the
existing workers using one content perspective and one process
perspective. Support your answer.
On your first day on a new IT job, your boss gives you this assignment: Because...
On your first day on a new IT job, your boss gives you this
assignment:
Because you completed coursework on usability, you are
responsible for evaluating the usability of the company website.
Include hard data in your report. You are required to use this
definition of usability:
The usability of a system or any product is a key factor for
all the organizations determining that everyone is having a good
user experience and easy to use. In the cutting-edge technology,...
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your
supervisor has asked that you review vaccines for an upcoming
training session for public health professionals. You will present
this information in a professional report. For this report, you
will select a vaccine-preventable disease or biological agent and
describe the characteristics of a homeostatic system in both health
and in a diseased state. Your report should include the
pathophysiological impact on the body system affected in disease,
how the disease...
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your
supervisor has asked that you review vaccines for an upcoming
training session for public health professionals. You will present
this information in a professional report. For this report, you
will select a vaccine-preventable disease or biological agent and
describe the characteristics of a homeostatic system in both health
and in a diseased state. Your report should include the
pathophysiological impact on the body system affected in disease,
how the disease...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V...
Your supervisor asked you to design a diode that has a total
junction capacitance at 0V of 1pF. You are asked to start with an
n-type GaAs wafer with a doping of 1x1017 cm-3, then create the
p-type layer by doping the substrate with accepters. The substrate
manufacturer told you that the GaAs substrate has trap centers
equal to 2x1014 cm-3 and capture cross-sections for electrons and
holes was of 1.0x10-12 cm2. After designing the diode, you are
asked to...
Your supervisor has asked you to prepare some calculations based on the company’s data and then...
Your supervisor has asked you to prepare some calculations based
on the company’s data and then research publicly available similar
competitor information to see how your company is performing within
the industry. Your company, CarryIt Inc., produces mass quantity,
inexpensive tote bags for promotional marketing purposes, which is
a very competitive business.
Here is the available data for your company:
Labor hours .25;
Labor rate $11.75/hour;
Materials input .5 yds. fabric;
Materials price $1.50/yd.; and
Variable overhead rate of $5.00...
You are a new employee just hired with ABC Inc. your supervisor has explained your job...
You are a new employee just hired with ABC Inc. your supervisor
has explained your job to you and has indicated that you will have
a great deal of control over your job once you develop your skills
and improve yourself. He compliments your history of accepting
responsibility and suggest that you are to feel free to offer
constructive criticism about the way your job.
Identify and define the type of theory ABC manager is applying
in dealing with his...
For the purpose of this assignment, your uncle has decided to retire and has asked you...
For the purpose of this assignment, your uncle has decided to
retire and has asked you to take over his Bed and Breakfast Inn
(B&B). It is currently organized as a sole proprietorship and
has fairly regular annual repeat customers (mostly families on
vacation). Review and answer the following questions:
What changes do you think you might implement to make the
B&B more successful?
Would you stay with a sole proprietorship? Why?
If you are going to change the type...
1. ⦁ Your supervisor has asked you to desine PCR primers to amplify the following region...
1. ⦁ Your supervisor has asked you to desine PCR
primers to amplify the following region in the human genome.
5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA
GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC
TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC
TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG
AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT
GGATGCTTGCATTACCAAGGCAAGCT -3’
Here is the sequence for the forward/right primer. 5’-
CGTTCGTAATCTTGGTGAATTAAT-3’
a) Was this primer designed to bind the DNA strand given above
or the complementary strand? Hint: you may want to write out the
complementary sequence to this DNA sequence to help you answer this
question.
b) Underline the bases where this...
ADVERTISEMENT
ADVERTISEMENT
Latest Questions
- Case 7 of the textbook examines the rise of Wal-Mart as a corporate bohemoth. One of...
- The type of listening that involves trying to understand a situation from the speaker’s perspective is...
- Based on the loanable funds theory, explain how each of the following changes should impact interest...
- research paper: each student will be responsible for writing an argumentative research paper discussion a topic...
- In java based on the classes provided finish the program per the requirements: ----------------------------------------------Class1 package cardgame;...
- Identify two cultures and analyze the nurturing process within each culture and discuss the impact the...
- Digital security is an increasing concern is the Internet age. In order to protect sensitive information...
ADVERTISEMENT