Question

In: Civil Engineering

In your first assignment on the job, your supervisor has asked you to report on the...

In your first assignment on the job, your supervisor has asked you to report on the company’s competitors future products. You really want to succeed. What do you do?

A. You could call the competitors pretending you are a college student working on project needing information

B. You could ask a college friend to call the competitors and ask for the information

C. You could call the competitors, but would not tell them who you really are unless if asked

D. You could call the competitors, explaining from the beginning who you really are, and ask for information

Solutions

Expert Solution

Solution)

In your first assignment on the job, your supervisor has asked you to report on the company’s competitors future products. You really want to succeed. What do you do?

D. You could call the competitors, explaining from the beginning who you really are, and ask for information

As in this situation it is the most ethical on your part and other competitior may give the types of products they are working on rather than th details and specifications of the product. On the other hand if you pretend to be college student take help from your friend then it will pretend that you are cheating the competitor and may competitor will not give the details of the product and you will not get the details Thus it is the best choice to simply ask the complete details about the product and by giving your full details and your task assigned this will help you surely and competitor will give you detail about the future products


Related Solutions

Your supervisor has asked you to explain the value of the fact that you completed this...
Your supervisor has asked you to explain the value of the fact that you completed this accounting course.
Assume that you are a manager in a factory and your supervisor has asked you increase...
Assume that you are a manager in a factory and your supervisor has asked you increase productivity without hiring additional workers or incurring overtime. Describe how you could motivate the existing workers using one content perspective and one process perspective. Support your answer.
On your first day on a new IT job, your boss gives you this assignment: Because...
On your first day on a new IT job, your boss gives you this assignment: Because you completed coursework on usability, you are responsible for evaluating the usability of the company website. Include hard data in your report. You are required to use this definition of usability: The usability of a system or any product is a key factor for all the organizations determining that everyone is having a good user experience and easy to use. In the cutting-edge technology,...
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your supervisor has asked that you review vaccines for an upcoming training session for public health professionals. You will present this information in a professional report. For this report, you will select a vaccine-preventable disease or biological agent and describe the characteristics of a homeostatic system in both health and in a diseased state. Your report should include the pathophysiological impact on the body system affected in disease, how the disease...
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your supervisor has asked that you review vaccines for an upcoming training session for public health professionals. You will present this information in a professional report. For this report, you will select a vaccine-preventable disease or biological agent and describe the characteristics of a homeostatic system in both health and in a diseased state. Your report should include the pathophysiological impact on the body system affected in disease, how the disease...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V of 1pF. You are asked to start with an n-type GaAs wafer with a doping of 1x1017 cm-3, then create the p-type layer by doping the substrate with accepters. The substrate manufacturer told you that the GaAs substrate has trap centers equal to 2x1014 cm-3 and capture cross-sections for electrons and holes was of 1.0x10-12 cm2. After designing the diode, you are asked to...
Your supervisor has asked you to prepare some calculations based on the company’s data and then...
Your supervisor has asked you to prepare some calculations based on the company’s data and then research publicly available similar competitor information to see how your company is performing within the industry. Your company, CarryIt Inc., produces mass quantity, inexpensive tote bags for promotional marketing purposes, which is a very competitive business. Here is the available data for your company: Labor hours .25; Labor rate $11.75/hour; Materials input .5 yds. fabric; Materials price $1.50/yd.; and Variable overhead rate of $5.00...
Your supervisor has asked you to evaluate the relative attractiveness of the stocks of two very...
Your supervisor has asked you to evaluate the relative attractiveness of the stocks of two very similar chemical companies. Litchfield Chemical Corp. (LCC) and Aminochem Company (AOC). Both firms have a June 30 fiscal year end. You have compiled the data in Table 1 for this purpose. Use a 1-year time horizon and assume the following: Real gross domestic product is expected to rise 5%; S&P 500 expected total return of 20%; U.S. Treasury bills yield 5%; and 30 year...
You are a new employee just hired with ABC Inc. your supervisor has explained your job...
You are a new employee just hired with ABC Inc. your supervisor has explained your job to you and has indicated that you will have a great deal of control over your job once you develop your skills and improve yourself. He compliments your history of accepting responsibility and suggest that you are to feel free to offer constructive criticism about the way your job. Identify and define the type of theory ABC manager is applying in dealing with his...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region in the human genome. 5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT GGATGCTTGCATTACCAAGGCAAGCT -3’ Here is the sequence for the forward/right primer. 5’- CGTTCGTAATCTTGGTGAATTAAT-3’ a) Was this primer designed to bind the DNA strand given above or the complementary strand? Hint: you may want to write out the complementary sequence to this DNA sequence to help you answer this question. b) Underline the bases where this...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT