Question

1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region in the human genome.

5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA

GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC

TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC

TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG

AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT

GGATGCTTGCATTACCAAGGCAAGCT -3’

Here is the sequence for the forward/right primer. 5’- CGTTCGTAATCTTGGTGAATTAAT-3’

a) Was this primer designed to bind the DNA strand given above or the complementary strand? Hint: you may want to write out the complementary sequence to this DNA sequence to help you answer this question.

b) Underline the bases where this primer will bind to its target sequence.

c) What is the first base that will be added by the Taq DNA polymerase that extends from this primer?

d) Assume the reverse/left primer is the same length as the forward/right primer, 24bp long.

i. What would the sequence be for this primer (indicate 3’ and 5’ ends of the primer)?

ii. Was this primer designed to bind the DNA strand given above or the complementary strand?

iii. What is the first base that will be added by the DNA polymerase that extends from this primer?

Answer 1

a) Primers are fesigned in a way so that they can provide the 3' end for the binding of DNA polymeras as the enzyme requires the 3' OH group to initiate the synthesis of the complementary strand by extending the 3' end of the preexisting nucleotide chain(primer). So to design the forward primer it is needed that the 3' end is free for the enzyme attachment. Therefore the forward primer is design complementing the bottom or the complemetary strand of the template strand. This means that the forward primer contains the same nucleotide sequence as the template strand.

Therefore this forward primer is designed to bind to the complementar strand.

b) The primer 5’- CGTTCGTAATCTTGGTGAATTAAT-3’ will bind to the complementary counterpart i.e 3'GCAAGCATTAGAACCACTTAATTA5'

c) Cytosine (C) will be the first nucleotide that the polymerase will extend from this primer beacause after the primer sequence the first bas on the complementary strand will be Guanine(G).

d) i) Reverse primer sequence: 5' AGCTTGCCTTGGTAATGCAAGCAT 3'

ii) This reverse is designed to bind to the above given DNA strand at the 3' end so the synthesis of the new strand strats from 5'-3' end

iii) As the base after the primer on the template is Guanine (G) so the polymerase will adds its complementary on the primer i.e Cytosine (C).