List the allowed quantum numbers m_l and m_s for the following subshells and determine the maximum occupancy of the subshells. a) 2p b) 3d c) 4f d) 5g

Vancouver manufacturing Ltd. manufactures a variety of high quality electronic components. Data from the last three months are presented below:

You are the controller for Vancouver manufacturing and you are reviewing the performance over the last 3 months. In addition, the controller notes that the company, although it has many detailed performance measures, is considering implementing a balanced scorecard and asks you to identify the measures you think would be most appropriate to include in the balanced scorecard.

Required:

Evaluate the performance of the company and prepare a detailed Balanced Scorecard.

IN PSEUDOCODE AND JAVA SOURCE CODE PLEASE:

Program 0 (Warm-up, 40 pts): Deoxyribonucleic acid, or DNA, is comprised of four bases: (G)uanine, (C)ytosine, (A)denine and (T)hymine. Ribonucleic acid, or RNA, is different than DNA in that it contains no Thymine; thymine is replaced with something called (U)racil. For this assignment, you will create an array of 255 characters. You must start by filling the array with random characters of G, C, A and T.   You must then print out the array. Next, replace all the instances of Thymine with Uracil. Finally, you must print out the array again. In your solution, you must write at least one function that contributes to the solution. You must use the length attribute of the array in your answer.

Sample run

CATGGCGTCTTGCCAAGGCGGTTCCTTGTCTTGATGATGGCTGCGAGTTCCGAGTCGCCTTTTCTATGAGTCGCGAAGTATGCGGTCAAATTATGCTTGTCCGCTGTACTAGGCCCACGGATCTCCTCAGACAGCGTCGATGTCGGAATTCGCGGGGAGGAATACTAAACATGCTGAAGTTGATACATGTACAATTGCCGCGAACCAGGTGCACAGGGTGCCCAACGATCCATGTGGAACGAGAGCGATCTAGCC

CAUGGCGUCUUGCCAAGGCGGUUCCUUGUCUUGAUGAUGGCUGCGAGUUCCGAGUCGCCUUUUCUAUGAGUCGCGAAGUAUGCGGUCAAAUUAUGCUUGUCCGCUGUACUAGGCCCACGGAUCUCCUCAGACAGCGUCGAUGUCGGAAUUCGCGGGGAGGAAUACUAAACAUGCUGAAGUUGAUACAUGUACAAUUGCCGCGAACCAGGUGCACAGGGUGCCCAACGAUCCAUGUGGAACGAGAGCGAUCUAGCC

What are the essential elements of the design side of a systems SAD?

Equivalent Units and Related Costs; Cost of Production Report; Entries

Dover Chemical Company manufactures specialty chemicals by a series of three processes, all materials being introduced in the Distilling Department. From the Distilling Department, the materials pass through the Reaction and Filling departments, emerging as finished chemicals.

The balance in the account Work in Process—Filling was as follows on January 1:

The following costs were charged to Work in Process—Filling during January:

During January, 34,500 units of specialty chemicals were completed. Work in Process—Filling Department on January 31 was 3,000 units, 30% completed.

Required:

1. Prepare a cost of production report for the Filling Department for January. If an amount is zero, enter "0". If required, round your cost per equivalent unit answers to two decimal places.

2. Journalize the entries for (1) costs transferred from Reaction to Filling and (2) the cost transferred from Filling to Finished Goods. If an amount box does not require an entry, leave it blank.

3. Determine the increase or decrease in the cost per equivalent unit from December to January for direct materials and conversion costs. If required, round your answers to two decimal places.

4. Discuss the uses of the cost of production report and the results of part (3).

The cost of production report may be used as the basis for allocating product costs between   and  . The report can also be used to control costs by holding each department head responsible for the units entering production and the costs incurred in the department. Any differences in unit product costs from one month to another, such as those in part (3), can be studied carefully and any significant differences investigated.

Question 1: Rebel without a cause

Two drivers speed head-on toward each other and a collision is bound to occur unless one of them deviates at the last minute. If both deviate, everything is okay (they both win 1). If one deviates and the other does not, then it is a great success for the driver with iron nerves (he wins 2) and a great disgrace for the deviating driver (he loses 1). If both drivers have iron nerves, disaster strikes (both lose 2).

1. Write down the payoff matrix of this game.

2. Briefly (1-2 sentences) define the notion of Nash Equilibrium.

3. What are the Nash equilibria of this game?

Complete a Problem Solving discussion in Word. Your Problem Solving discussion should include Problem Statement, Problem Analysis, Program Design, Program Code and Program Test. For the Program Code section, use Raptor to code

1. Alberta Einstein teaches a business class at Podunk University. To evaluate the students in this class, she has given three tests. It is now the end of the semester and Alberta asks you to create a program that inputs each student’s test scores and outputs the average score for each student and the overall class average. (Hint: The outer loop should allow for Ms. Einstein to input all the students, one by one, and the inner loop should accept the three test scores and compute the average for each student.)

Write the balanced reaction equation for the precipitation of calcium carbonate from
potassium carbonate and calcium chloride. Don't forget to show the states of matter.

Using this balanced equation in the above question, determine the limiting reactant if 25 grams of calcium chloride
reacted with 25 grams of potassium carbonate. Show your work.

Differentiate between absolute poverty and relative poverty? Is absolute poverty concept is relevant to Pakistan? Explain how absolute poverty can be eliminated from LDC?

Comparative financial statement data for Carmono Company follow:

For this year, the company reported net income as follows:

This year Carmono declared and paid a cash dividend. There were no sales of property, plant, and equipment during this year. The company did not repurchase any of its own stock this year.

Required:

1. Using the indirect method, prepare a statement of cash flows for this year.

2. Compute Carmono’s free cash flow for this year.

The inverse demand equation for the output of a monopolist is P = 50 − 2Q. The monopolist's total cost equation is C(Q) = 100 + 2Q + Q2. What is the deadweight loss at the profit-maximizing output and price?

• $48

• $64

• $16

• $32

• None of the options.

Considering the Buddhist art we examined from we examined from India, China, and Japan, what might have been an advantage rulers gained by aligning themselves with the various incarnations of Buddhas and/or Bodhisattvas? What might have been a drawback?

1)Ghana Sewerage Company limited has employed you as a quality control
supervisor in the laboratory. Domestic waste water is brought to the company for
treatment. Before waste water treatment the following data was given to you.
 Weight of a dish = 47.6212
 100mL of sample is placed in the dish and evaporated. New weight of dish
and dry soils = 48.5432g
 The dish is placed in a 550◦C furnace, then cooled. New weight =48.4000g
Fine the
a. Total solids
b. Fixed solids
c. Total volatile solids

2)

a. pH is one of the most important controlling factors for treatment and
chemical analysis of water and wastewater explain.
b. As a water resource engineer for Ghana Water Company why is turbidity an
important in filtration and disinfection processes?
c. Groundwater usually has higher dissolved solids and surface water usually
has higher suspended solids explain.

3)

The current regulation state that all fecal liquid waste must be treated before
discharging into the sea or lagoon. You community has contacted you as a level
400 second semester civil engineering student to design a waste stabilization pond for the community to treat fecal liquid waste in the community. make a sketch of waste stabilization pond and describe to the community the process of treatment

This glass had a circular base, radius 2cm and height was 10cm. The opposite base, the opened one where you drink from, was an ellipse having half axes 3cm and 4cm. The intermediate section were ellipse changing smoothly from the circular elliptic shape: any section is an ellipse.

ICMP time expired error messages have two meaning? 1.) TTL expired is one reason 2.) what is the other time expired reason? explain fully with an example if possible.