Entries for Stock Dividends

Healthy Life Co. is an HMO for businesses in the Fresno area. The following account balances appear on Healthy Life’s balance sheet: Common stock (440,000 shares authorized ; 4,000 shares issued), $100 par, $400,000; Paid-In Capital in excess of par— common stock, $80,000; and Retained earnings, $3,600,000. The board of directors declared a 2% stock dividend when the market price of the stock was $139 a share. Healthy Life reported no income or loss for the current year.

If an amount box does not require an entry, leave it blank. If no entry is required, select "No entry required" from the dropdown.

a1. Journalize the entry to record the declaration of the dividend, capitalizing an amount equal to market value.

a2. Journalize the entry to record the issuance of the stock certificates.

b. Determine the following amounts before the stock dividend was declared: (1) total paid-in capital, (2) total retained earnings, and (3) total stockholders' equity.

c. Determine the following amounts after the stock dividend was declared and closing entries were recorded at the end of the year: (1) total paid-in capital, (2) total retained earnings, and (3) total stockholders' equity.

Purpose:To begin investigating the FAT16 file system on a USB memory device. In particular, you will add a file to a FAT16 formatted device and observe the changes made to the FAT table.

Deliverables: For Steps 7, 8, 11, and 12 you are to describe, in detail, what happens to the FAT when a file is added. Be specific and explain WHAT happened and WHY. It is acceptable to add small screen shots to you DOC file, but only as an aid in describing your observations.

Activities:

1. Use a USB flash drive that contains NO data that you need.
   1. You will want this flash drive to be as small as possible!
   2. Really! You want this to be as small as possible.
2. Format the drive with the FAT16 file system.
   1. During the format process name your drive “YourName-1a”
3. Using FTK Imager add this device as an evidence item.
4. Select FAT1 and do a screen shot of the Hex View window.
5. Close FTK Imager.
6. Add a small text file to the root directory of the Flash drive.
7. Using FTK Imager add this device as an evidence item.
   1. Find FAT1 and do a screen shot of the Hex View window.
   2. Compare the 2 screen shots and write down the chain of sectors that contain the text file.
8. Select the text file in the File List window.
   1. Look at the Status Bar and identify the sector number.
   2. Compare that cluster number to the Cluster Chain. They should match (+1 offset) If they don’t match, repeat the process starting at step 7 to identify your problem.
9. Close FTK Imager
10. Add a medium sized image file to the root directory of the Flash drive.
11. Using FTK Imager add this device as an evidence item.
    1. Find FAT1 and do a screen shot of the Hex View window.
    2. Compare the 2 screen shots and write down the chain of sectors that contain the image file.
12. Select the image file in the File List window.
    1. Look at the Status Bar and identify the sector number.
    2. Compare that cluster number to the Cluster Chain. They should match (+1 offset) If they don’t match, repeat the process starting at step 7 to identify your problem.
13. Close FTK Imager

*******IN PSEUDOCODE AND C++******* Program 0 (Warm-up, 40 pts): Deoxyribonucleic acid, or DNA, is comprised of four bases: (G)uanine, (C)ytosine, (A)denine and (T)hymine. Ribonucleic acid, or RNA, is different than DNA in that it contains no Thymine; thymine is replaced with something called (U)racil. For this assignment, you will create an array of 255 characters. You must start by filling the array with random characters of G, C, A and T.   You must then print out the array. Next, replace all the instances of Thymine with Uracil. Finally, you must print out the array again. In your solution, you must write at least one function that contributes to the solution. You must use the length attribute of the array in your answer.

Sample run

CATGGCGTCTTGCCAAGGCGGTTCCTTGTCTTGATGATGGCTGCGAGTTCCGAGTCGCCTTTTCTATGAGTCGCGAAGTATGCGGTCAAATTATGCTTGTCCGCTGTACTAGGCCCACGGATCTCCTCAGACAGCGTCGATGTCGGAATTCGCGGGGAGGAATACTAAACATGCTGAAGTTGATACATGTACAATTGCCGCGAACCAGGTGCACAGGGTGCCCAACGATCCATGTGGAACGAGAGCGATCTAGCC

CAUGGCGUCUUGCCAAGGCGGUUCCUUGUCUUGAUGAUGGCUGCGAGUUCCGAGUCGCCUUUUCUAUGAGUCGCGAAGUAUGCGGUCAAAUUAUGCUUGUCCGCUGUACUAGGCCCACGGAUCUCCUCAGACAGCGUCGAUGUCGGAAUUCGCGGGGAGGAAUACUAAACAUGCUGAAGUUGAUACAUGUACAAUUGCCGCGAACCAGGUGCACAGGGUGCCCAACGAUCCAUGUGGAACGAGAGCGAUCUAGCC

Python regex

How to write the regex in Python that only include the contents within a parentheses?

e.g. "uio" [ek3k 0die] 4229834

return "ek3k 0die"

Java program Test Scores?

Design a TestScore class that has three integer fields, each holding a test score. The
class should have accessor and mutator methods for the test score fields and a method that
returns the average of the test scores as a double.

Test the TestScore class by writing a separate program that creates an instance of the class. The program should ask the user to enter three test scores, which should be stored in the TestScore object. The program should then print the average of the scores.

Conception to Birth: Write One Paragraph explaining The Importance of Studying Life-Span Development

Topic is on NIKE

Competitive Advantages

List the competitive advantages of the product, service or organization you’re focusing on: the things that make it different from competitors in positive ways.

Market Niche and Positioning Strategy

Describe the market niche you want to fill, along with the positioning strategy you recommend using. Why do you think this is the right approach?

Positioning Statement

Develop a positioning statement using this formula: “To [target audience], [product/service/organization name] is the only [category or frame of reference] that [points of differentiation/benefits delivered] because [reasons to believe].

Repositioning Considerations

Do you recommend a repositioning that improves on what the organization has been using up to this point? Why or why not?

(PYTHON)

prompt the user to enter a single-digit num and print that num as follow:

1) use loops

2) print num in words. Example: 5 is 'five'

3) the number of spaces that go back and forth should equal the num

if the user inputs 5, the program prints:

five

. . . . .five

five

. . . . . five

five

and 2 would be:

two

. .two

(the periods(.) are only for demonstration purposes. Don't include it in the actual output).

Phillips Company bought 30 percent ownership in Jones Bag Company on January 1, 20X1, at underlying book value. During the period of January 1, 20X1, through December 31, 20X3, the market value of Phillips' investment in Jones' stock increased by $1,500 each year. In 20X1, 20X2, and 20X3, Jones Bag reported the following:

The balance in Phillips Company’s investment account on December 31, 20X3, was $71,000.

Required:
In each of the following independent cases, determine the amount that Phillips paid for its investment in Jones Bag stock assuming that Phillips accounted for its investment by carrying the investment at fair value, or using the equity method.
  

Describe social bandwidth and share an experience you’ve had with this concept within your previous

Need 300 words

The pKb values for the dibasic base B are pKb1 = 2.10 and pKb2 = 7.37. Calculate the pH at each of the following points in the titration of 50.0 mL of a 0.55 M B(aq) with 0.55 M HCl(aq).

(a) before addition of any HCl

(b) after addition of 25.0 mL of HCl

(c) after addition of 50.0 mL of HCl

(d) after addition of 75.0 mL of HCl

(e) after addition of 100.0 mL of HCl

Julius Caesar used one of the earliest known cipher systems to communicate with Cicero in Rome while he was conquering Europe. Caesar knew that there was a very high risk of ambush or spies when sending messages; therefore, he developed a cryptographic system now known as the Caesar cipher.

Primary Task Response:

Please provide a detailed response to the below to include specific details and examples.

• What is the Caesar ROT3 Cipher?
• How does it work?
• Although the Caesar cipher is easy to use, it is easy to crack. How would an attacker break a Caesar-style cipher?

Ben buys a 180-day $100 000 bank bill, 30 days after issue, for a price of $98 140.70 (the purchase yield is 4.61% p.a.). After holding the bill for 30 days Ben sells it at a yield of 4.56% p.a. (simple interest).

a. Construct a Cash flow diagram from Ben's perspective

b. Find the sale price.

c. Find Ben's simple interest yield p.a. (as a percentage, rounded to 2 decimal places) over the 30-day holding period.

d. Explain how Ben's yield calculated in b. would change (increase or decrease) if the sale yield was less than 4.56% p.a. Why would the yield change in this way?

e. When a bank bill is purchased and sold before maturity the dollar return consists of two components—a capital component and an interest component. State how to calculate the capital component.

f. Explain in your own words and with reference to the purchase yield and the sale yield when the capital component will be a gain and when it will be a loss.

g. Use your explanation in (f.) to determine whether the capital component of Ben's bank bill investment will be a gain or a loss. Note that you are not required to calculate the actual value of the capital component.

Explain succinctly how to solve the following problem efficiently: Given two arrays, determine which elements appear in both arrays