Questions
There is a region with a constant magnetic field 6.31T . The magnetic field is directed...

There is a region with a constant magnetic field 6.31T . The magnetic field is directed out of the page. A conducting rod moves with a velocity of 1.58m/s , along a V shaped wire that is in the shape of a right triangle. At time = 0 s the rod is at the vertex of the triangle where the angle at the vertex is 19degrees . The right angle is where the conducting rod is. This means the rod is moving along the x axis and the rod is the y axis.

What is the emf induced in the rod after it has moved from the vertex for a time of 10.9s ?

emf = V

What is the current induced in the rod if the resistance is 5.31ohms ?

i = A

What is the power in the rod?

P = W

In: Physics

A 42-year-old man presents with an 8-hour history of testicular pain, which is increasing in severity....

A 42-year-old man presents with an 8-hour history of testicular pain, which is increasing in

severity. He is in acute distress by the time you see him and complains of groin pain. He

notes some urinary frequency and nausea. His physical ex is unremarkable with

normal testicular and scrotal ex and mild left costovertebral angle tenderness.

Urinalysis reveals significant microscopic hematuria.

Questions:

1. Will you treat and/or refer? What follow-up is needed?

2. What education is needed for this patient for the future?

3. Are there any complementary therapies to assist this patient in control of his underlying condition long range? Support with evidence from the literature.

In: Nursing

Briefly define the following airborne materials, and provide two examples of how each is generated: dusts,...

Briefly define the following airborne materials, and provide two examples of how each is generated: dusts, fumes, smoke, aerosols, mists, gases, and vapors. Please provide your response in sentence/paragraph form rather than as bullets. Your response must be at least 200 words in length .
no coping and paste

In: Operations Management

Given a queue of integers, write an algorithm in Pseudocode that, using only the queue ADT,...

Given a queue of integers, write an algorithm in Pseudocode that, using only the queue ADT, calculates and prints the sum and the average of the integers in the queue without changing the contents of the queue.

In: Computer Science

Question: How would a long exposure time affect the image of a moving projectile? Give me...

Question: How would a long exposure time affect the image of a moving projectile?

Give me one paragraph of answer if possible. Thank You. This is physics Prelab question.

In: Physics

in C++, please show step by step with simple codes. thank you An application from Biology...

in C++, please show step by step with simple codes. thank you
An application from Biology
The only built-in function you can use is length.
1. As a starting point, write a piece of pseudocode for a function that finds a substring of a string. Your
function should take as input the string, the starting point of the desired substring, and the length of the desired substring. For example, substring(“abracadabra”, 3, 5) should return “acada”.

2. Turn your pseudocode from 1 into C++ code. Run your code with several outputs to be sure it’s right.

3. We may wish to look for occurrences of specific protein sequences (that correspond to certain traits) in a strand of DNA. For instance, if you were looking for the protein sequence "AATG" in the DNA strand "ATGCAGAAAGCTACGATCAATGATCGATC AATGGAT", you would find that it starts at index 18. Note that there is more than one match, but we’ve found the starting index of the first one.
Write a piece of pseudocode, using your function from 1 and 2, that finds the index of the start of the the first match of a given string protein within the string dna. In our example above, protein would be “AATG” and dna would be "ATGCAGAAAGCTACGATCAATGATCGATC AATGGAT".

4. Turn your pseudocode from 3 into C++ code. Run your code with several outputs to be sure it’s right.

In: Computer Science

It's your birthday, and to celebrate you're going to make your first bungee jump. You stand...

It's your birthday, and to celebrate you're going to make your first bungee jump. You stand on a bridge 120 m above a raging river and attach a 30-m -long bungee cord to your harness. A bungee cord, for practical purposes, is just a long spring, and this cord has a spring constant of 45 N/m . Assume that your mass is 71 kg . After a long hesitation, you dive off the bridge.

Part A

How far are you above the water when the cord reaches its maximum elongation?

Express your answer with the appropriate units.

In: Physics

I need an equation for finding the veocity of water at the end of an incline....

I need an equation for finding the veocity of water at the end of an incline.

  • the velocity at the top is 0
  • the incline is a right triangle with a hieght of 3000ft and a base of 9 miles
  • the fluid is water
  • the depth of the water is 3ft

In: Physics

legal aspects of engineering 1. What remedies are available to a seller if the buyer refuses...

legal aspects of engineering

1. What remedies are available to a seller if the buyer refuses to pay for goods the buyer has accepted?

2. Describe the relationships between the parties to a construction contract.

3. What are the inherent advantages of standardized specifications?

4. Why must real estate transactions be recorded?

In: Operations Management

Calculate the pH of the solution at each step after the addition of i) 0.00mL ii)...

Calculate the pH of the solution at each step after the addition of i) 0.00mL ii) 2.30 mL, iii) 10.0 and iv) 16.0 mL of 0.50 M HCL to 100.0 mL of 0.10 M NH3 solution.

In: Chemistry

Your firm is evaluating a new $725,000 investment opportunity with a 16% required return. You expect...

Your firm is evaluating a new $725,000 investment opportunity with a 16% required return. You expect to sell 3,500 units per year at $50 net cash flow each for the next 8 years. Suppose that after one year, you will know more about demand and be able to revise your estimate of future unit sales based on sales you observe for year 1. Further, suppose that the project can be dismantled and sold to net $650,000 at that time.

a. What is the minimum level of unit sales for year 1 below which would it make sense to abandon the project?

b. If the original expectation of 3,500 unit sales is the average of two equally likely outcomes (3,000 units or 4,000 units), what is the value of the project, including the option to abandon at the end of the first year?

In: Finance

Two Earth satellites, A and B, each of mass m, are to be launched into circular...

Two Earth satellites, A and B, each of mass m, are to be launched into circular orbits about Earth's center. Satellite A is to orbit at an altitude of 7530 km. Satellite B is to orbit at an altitude of 24200 km. The radius of Earth REis 6370 km. (a) What is the ratio of the potential energy of satellite B to that of satellite A, in orbit? (b) What is the ratio of the kinetic energy of satellite B to that of satellite A, in orbit? (c) Which satellite (answer A or B) has the greater total energy if each has a mass of 28.5 kg? (d) By how much?

In: Physics

you will select a somatoform or dissociative disorder discussed in Chapter 5, then discuss some of...

you will select a somatoform or dissociative disorder discussed in Chapter 5, then discuss some of the possible causes and treatments that are available. Don't forget to reference your sources at the end of your initial post.

In: Psychology

Be sure your answer is complete and include any relevant diagrams and examples. 3 paragraphs minimum....

Be sure your answer is complete and include any relevant diagrams and examples. 3 paragraphs minimum.

Crime rates are higher in certain areas of a city, frequently the central city. How do residents and businesses of these areas respond to these higher crime rates? What impact does this have on the entire city? Be sure to include the effect on tax revenue, city government spending, and any other effects.

In: Economics

Suppose that the first national bank currently holds a total of 45 million dollars in deposits...

Suppose that the first national bank currently holds a total of 45 million dollars in deposits from over 120,000 clients. At the same time, the total amount of loans people owe the bank is 18 million dollars, and the bank cannot legally issue more loans without attracting additional deposits. Assume that the bank currently has 3 million dollars in cash and 2 million dollars worth of securities invested in the financial market. The bank also owns some physical assets, such as its office building.

Suppose now someone saves another $52 into his checking account at the first national bank, what is the maximum amount of deposits that can be generated (including this initial deposit) by the fractional reserve banking system?

Round your answer to 2 digits after the decimal point.

In: Economics