Question

In: Biology

Describe the process by which the information in a gene is transcribed and translated into a...

Describe the process by which the information in a gene is transcribed and translated into a protein. Correctly use these words in your description (and highlight them as bold text in your submission):

  • tRNA
  • amino acid
  • start codon
  • transcription
  • mRNA
  • gene
  • codon
  • RNA polymerase
  • ribosome
  • translation
  • anti-codon
  • peptide bond
  • stop codon

Solutions

Expert Solution

Transcription is a process in which DNA is transcribed into RNA.It is first step of gene expression. RNA polymerase is main transcription enzyme.RNA polymerase uses a ssDNA template to synthesize complemetary strand of RNA.When RNA polymerase binds to promoter region of template strand near beginning of gene,transcription begins.One strand of DNA acts as template strand while other acts as coding strand.Termination occurs when termination sequences are transcribed.

In eukaryotes,transcription factors bind first,helping RNA polymerase.Eukaryotes have TATA box which is recognized by the transcription factors and allows RNA polymerase to bind.Next is the process of elongation.During this,RNA polymerase walks along template strand and adds a complementary nucleotide to the 3' end of strand.Transcription terminates via rho termination in prokaryotes.

In eukaryotes,RNA molecules must be processed after transcription.They are spliced and introns (non coding segments) are removed and have a 5' cap and poly-A tail on their ends.

Translation is process of conversion of mRNA to polypeptide chain.The codons of mRNA are read by transfer RNA in 5' to 3' direction.Each tRNA has anticodon, a set of three nucleotides that binds to matching mRNA codon through base pairing.The other end of tRNA carries amino acid that's specified by the codon.Initiation of translation occurs by forming a initiation complex.It comprises of mRNA,ribosome and tRNA carrying amino acid usually methionine.

tRNA carrying methionine binds to small ribosomal unit.tRNA binds to 5' end of mRNA by recognizing GTPCap.Then they walk along in 3' to 5' direction until start codon.Further large subunit joins initiation complex.In prokaryotes Shine Dalgarno sequence is present before start codon.

Chain elongation-When met-tRNA occupies P site of of ribosome( peptide chain),another aminoacyl-tRNA occupies A site.It requires GTP.Enzyme peptidyl transferase forms a peptide bond between methionine and next amino acyl tRNA.In this manner peptide chain is built from N to C terminus.

Chain terminates when stop codon in mRNA enters A site.Ribosomal units dissociate and peptide chain is released in cytoplasm.


Related Solutions

1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. 2.You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in these faecal samples...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. 2.Describe the principles behind and the applications of the following: a) Northern blotting b) Site-directed mutagenesis c) DNase l footprinting d) Fusion protein vectors e) Sanger Sequencing of DNA 3.Describe six differences between DNA replication in bacteria compared with eukaryotes.
Question 1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA,...
Question 1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. Question 2. You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in...
1.Discuss the mechanisms that control the regulation of gene expression, after mRNA is transcribed. •Cis- and...
1.Discuss the mechanisms that control the regulation of gene expression, after mRNA is transcribed. •Cis- and Trans-acting elements can u tell me plzz in brief
Describe the process of gene regulation using the diphtheria toxin gene. More correct, relevant detail is...
Describe the process of gene regulation using the diphtheria toxin gene. More correct, relevant detail is better.
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’...
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’ 5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’ Within the double-stranded DNA above: a. Which strand ( top / bottom ) is the coding strand? b. Circle the -10 promoter element. c. Underline a single nucleotide indicating the transcription start site. d. Circle the translation start and stop codons. e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always...
How is "Comparable worth" translated in the hiring process. How is it related to the Equal...
How is "Comparable worth" translated in the hiring process. How is it related to the Equal pay issues in the work place?
Describe the process of protein synthesis in prokaryotic cells. Begin with a gene in the DNA...
Describe the process of protein synthesis in prokaryotic cells. Begin with a gene in the DNA and throughly explain all of the steps of transcription (initiation , elongation, termination and one type of termination. Describe translation(initiation, elongation, termination) that result in the formation of a functional protein. Be specific as to the mechanism of each step.
Describe the process by which organizations develop their information systems. - Minimum 200 words
Describe the process by which organizations develop their information systems. - Minimum 200 words
1a. You are researching a gene involved in the process of glycolysis. Which of the following...
1a. You are researching a gene involved in the process of glycolysis. Which of the following would you expect to see in terms of regulation of this gene?  Select all that apply. it should be induced by glucose it should be repressed by glucose it should be induced by high ATP levels it should be amplified when glucose is depleted 1b. If you are genetically engineering a protein that you want to accumulate in the endoplasmic reticulum of a eukaryotic cell,...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT