Question

In: Biology

22) Which of the following is true? A. Cells transcribe and translate every gene they have,...

22) Which of the following is true?
A. Cells transcribe and translate every gene they have, but only activate proteins that they need.
B. All cells in your body have the same DNA, but cells function differently because they turned on
only certain genes needed for that cell’s job.
C. Mature cells have different DNA because they only carry the genes they need for their job.
D. Cells transcribe every gene they have, but only translate those that they need.


23) Athletes who abuse anabolic steroids often demonstrate different effects such as muscle growth, loss of libido and aggression. How can this be explained at the cellular level?
    A. Testosterone is a repressor of genes controlling these traits.
    B. Testosterone binds to different receptors and turns on a variety of genes controlling the traits.
    C. Testosterone adds a methyl group to the DNA turning genes on.
    D. Testosterone blocks enzymes which control these traits.

24) Which of the following supports the argument that viruses are nonliving?
A. They are not cellular.        B. They do not evolve.    C. They lack genetic material.
D. They have RNA rather than DNA.        E. Their DNA does not encode proteins

Solutions

Expert Solution

Question 22

Solution: All cells in your body have the same DNA, but cells function differently because they turned on
only certain genes needed for that cell’s job.

Because of differential expression of genes. Content and composition of DNA in the cell are the same. However, they turned on only certain genes needed. This is called  differential expression of genes

  • Cells do not transcribe and translate every gene they have and they do not have any such mechanism to activate proteins that they need
  • Mature cells do not have different DNA. DNA composition of all the cells are same and cells carry all the the genes. But theur expression is different
  • Cells do not transcribe all the genes they have. Cells transcribe only the genes that they need

Question 23

Solution Option B- Testosterone binds to different receptors and turns on a variety of genes controlling the traits.

anabolic steroids mimics the male sex hormone Testosterone and result in the activation of genes related to muscle growth, loss of libido and aggression. Testosterone is not a repressor of genes controlling these traits, it is an activator.Testosterone do not cause any methylation to the DNA. Methylation generally turn the genes of. Testosterone do not blocks enzymes which control these traits, instead it activate enzymes

Question 24

Solution - Option A. They are not cellular

  • Viruses are able to evolve(eg. pathogenic virus evolve to adapt to the changes in host immunity).
  • Viruses contain either RNA or DNA as genetic material.
  • DNA of virus are capable of encoding proteins.

Related Solutions

Please transcribe and translate the gene provided.   Please provide the code for the non-sense strand of...
Please transcribe and translate the gene provided.   Please provide the code for the non-sense strand of DNA too. Make sure you label the 3’ and 5’ ends of the nucleic acids, as well as the amino (NH3) group and the carboxyl (COO-) group of the peptide. 3’- CAATAATACGTGAAATAACCTTTATCAACGACGATCAGAGAG –5’
4. Transcribe and translate each of the following sequences. a. T A C A A A...
4. Transcribe and translate each of the following sequences. a. T A C A A A G A C G G G T C C b. G C A G G G C G A T T T A C A c. T A C G C G C A C G T T A G C d. C C G T G C A G G T A G A T T
1. Transcribe and translate the gene below. TAC GGG TTT CGC GCG AAA ATA ACT 2....
1. Transcribe and translate the gene below. TAC GGG TTT CGC GCG AAA ATA ACT 2. Contrast respiration and fermentation in terms of the need for oxygen, the number of ATP produced, and the requirement for an Electron Transport Chain. 3. If 5 molecules of FADH delivered their hydrogen to the Electron Transport Chain in a fully oxygenated eukaryotic cell, how many ATP would result? _____ (2, 5, 10, 24, 36) 4. If an anticodon is AGU, the original nucleotide...
Which of the following is not a true difference between animal cells and plant cells? Circle...
Which of the following is not a true difference between animal cells and plant cells? Circle all statements that are not true. A) Plant cells have cell walls around them, while animal cells do not B) Plant cells contain chloroplasts, while animal cells never do C) Plant cells have DNA in the form of chromosomes, while animal cells do not D) Plant cells can store water in a central vacuole, something not found in animal cells ​ E) Plant cells...
Which of the following is NOT true about genetic information & gene expression?
Question 1 Which of the following is NOT true about genetic information & gene expression? Genetic information must be copied to RNA RNA is translated at the ribosomes DNA is translated at the ribosomes DNA stores information Question 2 Which statement is INCORRECT about gene expression? Info must be copied to RNA DNA stores informationRNA is translated at the ribosomes DNA is translated at the ribosomes Question 3 Codons are 3 nucleotide sequences that mostly specify an amino acid 5 nucleotide sequences that mostly specify an amino acid amino acids in a protein single nucleotides that...
All cells must transcribe rRNA in order to construct a functioning ribosome. Scientists have isolated and...
All cells must transcribe rRNA in order to construct a functioning ribosome. Scientists have isolated and identified rRNA  genes that contribute to ribosomal structure for both prokaryotes and eukaryotes. Figure 1 compares the transcription and processing of prokaryotic and eukaryotic  rRNA. Figure 1. Comparison of rRNA processing in prokaryotes and eukaryotes Which of the following statements provides the best explanation of the processes illustrated in Figure 1 ? Introns are removed from the pre-rRNA, and the mature rRNA molecules are joined and...
which cells have cilia and which cells have flagella
which cells have cilia and which cells have flagella
Translate the following sentence into sentential logic. It is not true that ATHLETICISM is a necessary...
Translate the following sentence into sentential logic. It is not true that ATHLETICISM is a necessary and sufficient condition for FITNESS.
Which of the following is true about interferon? It is released by uninfected cells during a...
Which of the following is true about interferon? It is released by uninfected cells during a viral infection It is produced by virally infected cells during a viral infection, whereupon it inhibits further viral replication within the cells where it is made. It is produced by virally infected cells to activate helper T-cells. It is released by virally infected cells to induce an antiviral state in uninfected cells. It is released by cells in lymph nodes to attract T cells...
Which of the following is true regarding Langerhans cells and their activity? a) the Langerhans cell...
Which of the following is true regarding Langerhans cells and their activity? a) the Langerhans cell is a specialized epithelial cell made of especially large amounts of keratin b) they add pigment to keratinocytes in the stratum spinosum and this pigment acts to reduce the chance of UV radiation damage to the keratinocyte nucleus c) they are interfaced with underlying sensory neurons and enhance the detection of mechanical forces applied to the skin d) they sample the microflora found in...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT