Please transcribe and translate the gene provided. Please provide the code for the non-sense strand of...

Please transcribe and translate the gene provided. Please provide the code for the non-sense strand of DNA too.

Make sure you label the 3’ and 5’ ends of the nucleic acids, as well as the amino (NH3) group and the carboxyl (COO-) group of the peptide.

3’- CAATAATACGTGAAATAACCTTTATCAACGACGATCAGAGAG –5’

Expert Solution

Answer: Transcription: The process of formation of RNA transcript from DNA is calle transcription.

Translation: the process of formation of formation of protein from RNA transcript is called translation.

Transcribed and translated products are explained below:

gladiator answered 2 months ago

22) Which of the following is true? A. Cells transcribe and translate every gene they have,...

22) Which of the following is true? A. Cells transcribe and translate every gene they have, but only activate proteins that they need. B. All cells in your body have the same DNA, but cells function differently because they turned on only certain genes needed for that cell’s job. C. Mature cells have different DNA because they only carry the genes they need for their job. D. Cells transcribe every gene they have, but only translate those that they need....

1. Transcribe and translate the gene below. TAC GGG TTT CGC GCG AAA ATA ACT 2....

1. Transcribe and translate the gene below. TAC GGG TTT CGC GCG AAA ATA ACT 2. Contrast respiration and fermentation in terms of the need for oxygen, the number of ATP produced, and the requirement for an Electron Transport Chain. 3. If 5 molecules of FADH delivered their hydrogen to the Electron Transport Chain in a fully oxygenated eukaryotic cell, how many ATP would result? _____ (2, 5, 10, 24, 36) 4. If an anticodon is AGU, the original nucleotide...

Please Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA...

Please Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution), and Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) 1) sequence: 3’ TAC CGA GGA ATG TAC GAC TGA ACG CTA ATT 5’. mutated sequence: 3’ AC CGA GGA ATG TAC GAC TGA ACG CTA ATT 5’. 2) sequence: 3’ TAC UUU CCU AAU AGG GGG GAC GCU UGU AGC ACG UAA 5’ mutated Sequence:...

Java: Translate the Student class from the code provided to UML, e.g., -----------------------------_ | Student |...

Java: Translate the Student class from the code provided to UML, e.g., -----------------------------_ | Student | ------------------------------ | -lastName: String | | -firstName: String | ----------------------------- Java Code: public class Student { private String lName; private String fName; private int age; private double gpa; public Student(String lname, String fname, int age, double gpa); public String lname(); public String fname(); public int age(); public double gpa(); public String toString() { return lName+ " " + fName+...

HCS12 Assembly code please. Translate the following code into assembly. Allocate each variable on the stack....

HCS12 Assembly code please. Translate the following code into assembly. Allocate each variable on the stack. Simulate your program and screenshot the final value of the variables in memory. { char A,B,C; int F; A = 2; B = 6; C = - 10; F = (A + B)*C; C = F +10 }

Translate following pseudo-code to MIPS assembly language cout << “\n Please input a number for $s0”;...

Translate following pseudo-code to MIPS assembly language cout << “\n Please input a number for $s0”; cin >> $s0; cout << “\n Please input a number for $s1”; cin >> $s1; cout << “\n Please input a number for $s2”; cin >> $s2; $t0 = $s0 / 8 - 2 * $s1 + $s2; cout << “\n the Value of the expression “$s0 / 8 - 2 * $s1 + $s2” is ”; cout >> $t0; return;

This is a Microbiology essay question. Please provide detailed answers. There is no single gene that...

This is a Microbiology essay question. Please provide detailed answers. There is no single gene that determines whether a bacterial cell is gram positive or negative. a. Give examples of two genes that code for parts of the cell wall (gram positive, negative, or both). b. Some phenotypes, like resistance to a particular antibiotic, are gained and lost by a bacterial lineage frequently. Why don’t we see bacterial lineages changing back and forth between gram positive and negative?

please answer part 2 . the code for part 1 is provided at the end. Part...

please answer part 2 . the code for part 1 is provided at the end. Part 1 There is a pair of functions in stdlib.h (make sure to include it) that are used for generating pseudo-random numbers. These are "srand" and "rand". Examples are on pages 686 and 687. E.g., function "srand(3)" provides the seed value of 3 to the srand function. (3 is just a number, and probably isn't even a good number for this purpose, but that's a...

Please code in Assembly Language Code solution using the provided template AL_Template_Irvine32.asm located towards the bottom...

Please code in Assembly Language Code solution using the provided template AL_Template_Irvine32.asm located towards the bottom of the question.. Debug programs with Visual Studio2017/19. Please add single line or block comments explaining the purpose or functionality of your code statements. 10.) Fibonacci Generator Write a procedure that produces N values in the Fibonacci number series and stores them in an array of doubleword. Input parameters should be a pointer to an array of doubleword, a counter of the number of...

Please provide HTML code for the following: - Create a page that lists a set of...

Please provide HTML code for the following: - Create a page that lists a set of audio files and shows their duration - Create a page that lists a set of video files and plays a different video when you click on the play icon

Question