A. What effects would result from surgical removal of each of the following? (6 pts) •...

A. What effects would result from surgical removal of each of the following? (6 pts) • Stomach • Gall bladder • Pancreas B. Removal of which one would have the biggest impact on digestion? The smallest impact? Explain your reasoning.

Expert Solution

A)

Gastrectomy or surgical removal of a part or whole of stomach, may lead to a condition known as dumping syndrome. The swallowed food reaches the intestine quickly and this may lead to problems like nausea, diarrhoea, sweating, flushing after eating, etc. There will be a feeling of fullness, even after consuming only a small quantity of food. Weight loss and vitamin B12 deficiency may also be seen.
Cholecystectomy or removal of gall stones, may produce digestive symptoms like fat indigestion, diarrhea, flatulence, constipation.
Pancreatectomy is the complete or partial removal of pancreas. It interferes with the digestion of food and also blood glucose levels. There may be indigestion, heartburn, diarrhea, constipation. Diabetes or hyperglycemia is also seen.

B) The largest impact on the digestive system would be after pancreatectomy. Digestive enzymes and artificial insulin will have to be provided in order to have a normal life. Smallest impact would be gastrectomy, as the storage and breakdown function of the stomach will be taken over by the intestines. Protein metabolism will aslo be carried out in the small intestine. A cholecystectomy on the other hand, will impact fat metabolism and hence fat consumption will have to be regulated.

Sydney Mullin answered 1 year ago

Digestion Essay Question (10 pts) A. What effects would result from surgical removal of each of...

Digestion Essay Question (10 pts) A. What effects would result from surgical removal of each of the following? (6 pts) • Stomach • Gall bladder • Pancreas B. Removal of which one would have the biggest impact on digestion? The smallest impact? Explain your reasoning. (4 pts)

2. (6 pts) Speculate on the effects of each of the following mutations on the translation...

2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way. (GpppG is the 5’ cap) 5’GpppGUAACAUGGUCGGACCAUGAC(A)2003’ Mutation that removes the editing pocket from isoleucine-tRNA synthetase. Mutation that prevents GTP hydrolysis of eEF1-a. Mutation that prevents binding of GTP by eEF2.

Does surgical fat removal or reshaping have permanent effects? Provide your opinion about the surgical fat...

Does surgical fat removal or reshaping have permanent effects? Provide your opinion about the surgical fat removal (liposuction)

(6 pts) What is the significance of each of the following in the study of astronomy:...

(6 pts) What is the significance of each of the following in the study of astronomy: (a) Dark Matter (b) 21 cm Radiation (5 pts) Describe the overall structure and main parameters of the Milky Way galaxy. (10 pts) Describe the main characteristics of Einstein’s Theory of General Relativity. (4 pts) Explain the major characteristics/properties of Pulsars.

9. (6 pts) What are outliers? Describe the effects of outliers on the mean, median, and...

9. (6 pts) What are outliers? Describe the effects of outliers on the mean, median, and mode.

6. Which of the following would you expect to result from a block of electron transfer...

6. Which of the following would you expect to result from a block of electron transfer at complex II. Check all correct answers and explain. a. Reduction in oxidative phosphorylation b. No change in the proton gradient across the inner mitochondrial membrane c. FADH2 accumulation d. Damage to the cells due to reactive oxygen species accumulation Explanation:

6) (8 pts, 4 pts each) State the order of each ODE, then classify each of...

6) (8 pts, 4 pts each) State the order of each ODE, then classify each of them as linear/nonlinear, homogeneous/inhomogeneous, and autonomous/nonautonomous. A) Unforced Pendulum: θ′′ + γ θ′ + ω^2sin θ = 0 B) Simple RLC Circuit with a 9V Battery: Lq′′ + Rq′ +(1/c)q = 9 7) (8 pts) Find all critical points for the given DE, draw a phase line for the system, then state the stability of each critical point. Logistic Equation: y′ = ry(1 −...

3. Show the string that would result from each of the following string formatting operations. If...

3. Show the string that would result from each of the following string formatting operations. If the operation is not legal, explain why. Use Python shell to solve this question (a) "Looks like {1} and {0} for breakfast".format("eggs", "spam") => (b) "There is {0} {1} {2} {3}".format(1,"spam", 4, "you") => (c) "Hello {0}".format("Susan", "Computewell") => (d) "{0:0.2f} {0:0.2f}".format(2.3, 2.3468) => (e) "{7.5f} {7.5f}".format(2.3, 2.3468) => (f) "Time left {0:02}:{1:05.2f}".format(1, 37.374) => (g) "{1:3}".format("14") =>

1.) Indicate whether each of the following items would result in net cash flow from operating...

1.) Indicate whether each of the following items would result in net cash flow from operating activities being higher (H) or lower (L) than net income. a.) Decrease in accounts payable. b.) Depreciation expense. c.) Decrease in inventory. d.) Gain on sale of assets. e.) Increase in accounts receivable. f.) Increase in deferred tax liabilities. g.) Decrease accrued liabilities. h.) Increase in prepaid expenses. i.) Increase in deferred revenue. j.)...

Surgical Instruments: insert an image and use of each of the following types of surgical instruments....

Surgical Instruments: insert an image and use of each of the following types of surgical instruments. Identify any of the following parts present on each instrument by labeling the instrument: box lock, spring handle, ratchets, serrations, cutting edge, and teeth. Needle holder: Splinter forceps: Standard hemostatic forceps: Suture scissors: Operating scissors: Thumb forceps: Scalpel: Bandage scissors: Sponge forceps: Used to hold sponges. Tissue forceps: Mosquito hemostatic forceps

Question