Question

In: Statistics and Probability

9. (6 pts) What are outliers? Describe the effects of outliers on the mean, median, and...

9. (6 pts) What are outliers? Describe the effects of outliers on the mean, median, and mode.


Solutions

Expert Solution

In a set of data outliers are the few data values that are significantly different from other data values. In other words, these are values that lie far away from all other data values when all values are arranged in ascending or descending order. The outlier can either be an extremely low score or an extremely high one.

Mean is calculated by taking all data values in consideration. Therefore, when an outlier is present, that value is also used in the calculation. If the outlier is extremely small, the mean will be smaller and if the outlier is large, the mean will increase.

Median is calculated as the middle value when data is arranged in ascending or descending order. So, no matter what the extreme scores are, the position of middle value will not change.

Mode is the data value with maximum frequency. The outliers cannot have very high frequency. Therefore, mode is also not impacted by the presence of outliers.

orchestra answered 1 year ago
Next > < Previous

Related Solutions

discuss the sensitivity of outliers for mean, median, interquartile range, range, variance and standar deviation
discuss the sensitivity of outliers for mean, median, interquartile range, range, variance and standar deviation
Provide Mean, Median, Mode, Upper and Lower Limit Any null or missing values Detect any outliers...
Provide Mean, Median, Mode, Upper and Lower Limit Any null or missing values Detect any outliers or data points of interest Provide a paragraph for each column with facts from the previous 3 bullets and provide the business context behind the importance of the column, showing the analysis and how this helps you in the preparation stages. Month Year N Obs Variable Mean Std Dev Minimum Maximum Median N N Miss 1 2016 3584 Day_of_Week Items_In_Cart Visit_To_Site Made_Purchase Member 4.0231585...
Describe in what cases the use of ‘‘median’’ can be preferred over that of ‘‘mean’’ in...
Describe in what cases the use of ‘‘median’’ can be preferred over that of ‘‘mean’’ in environmental data reporting?
A. What effects would result from surgical removal of each of the following? (6 pts) •...
A. What effects would result from surgical removal of each of the following? (6 pts) • Stomach • Gall bladder • Pancreas B. Removal of which one would have the biggest impact on digestion? The smallest impact? Explain your reasoning.
2. (6 pts) Speculate on the effects of each of the following mutations on the translation...
2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way.  (GpppG is the 5’ cap) 5’GpppGUAACAUGGUCGGACCAUGAC(A)2003’ Mutation that removes the editing pocket from isoleucine-tRNA synthetase. Mutation that prevents GTP hydrolysis of eEF1-a. Mutation that prevents binding of GTP by eEF2.
Study Guide #9 In this problem, we explore the effect on the mean, median, and mode...
Study Guide #9 In this problem, we explore the effect on the mean, median, and mode of adding the same number to each data value. Consider the data set 4, 4, 5, 8, 12. (a) Compute the mode, median, and mean. (Enter your answers to one decimal place.) mode median     mean (b) Add 5 to each of the data values. Compute the mode, median, and mean. (Enter your answers to one decimal place.) mode median     mean (c) Compare the results...
using the values 4,2,5,6,1,6,8,3,4 and 9. calculate the median, the arithmetic mean, the variance , standard...
using the values 4,2,5,6,1,6,8,3,4 and 9. calculate the median, the arithmetic mean, the variance , standard deviation and interquartile range
Describe the standard normal curve. a. What does the mean, median, and mode equal? How many...
Describe the standard normal curve. a. What does the mean, median, and mode equal? How many standard deviations are on the right side of the curve? How many standard deviations are on the left side of the curve? What does the y-axis represent? Draw the standard normal curve.
2. (2 pts) For the following scenarios, • describe what the mean parameter µ represents in...
2. (2 pts) For the following scenarios, • describe what the mean parameter µ represents in each scenario, and • set up H0 and Ha related to µ (i.e. What hypotheses would you test to assess the specification/claim/belief?) Do not perform the hypothesis tests. a. A random sample of 30 pieces of acetate fiber has a sample mean absorbency of 15% with a sample standard deviation of 1.5%. Is there strong evidence that this fiber has a true mean absorbency...
2. (2 pts) For the following scenarios, • describe what the mean parameter µ represents in...
2. (2 pts) For the following scenarios, • describe what the mean parameter µ represents in each scenario, and • set up H0 and Ha related to µ (i.e. What hypotheses would you test to assess the specification/claim/belief?) Do not perform the hypothesis tests. a. A random sample of 30 pieces of acetate fiber has a sample mean absorbency of 15% with a sample standard deviation of 1.5%. Is there strong evidence that this fiber has a true mean absorbency...
ADVERTISEMENT
Subjects
ADVERTISEMENT
Latest Questions
ADVERTISEMENT