2. (6 pts) Speculate on the effects of each of the following mutations on the translation...

2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way. (GpppG is the 5’ cap)

5’GpppGUAACAUGGUCGGACCAUGAC(A)₂₀₀3’

Mutation that removes the editing pocket from isoleucine-tRNA synthetase.

Mutation that prevents GTP hydrolysis of eEF1-a.

Mutation that prevents binding of GTP by eEF2.

Expert Solution

gladiator answered 4 months ago

A. What effects would result from surgical removal of each of the following? (6 pts) •...

A. What effects would result from surgical removal of each of the following? (6 pts) • Stomach • Gall bladder • Pancreas B. Removal of which one would have the biggest impact on digestion? The smallest impact? Explain your reasoning.

(6 pts) What is the significance of each of the following in the study of astronomy:...

(6 pts) What is the significance of each of the following in the study of astronomy: (a) Dark Matter (b) 21 cm Radiation (5 pts) Describe the overall structure and main parameters of the Milky Way galaxy. (10 pts) Describe the main characteristics of Einstein’s Theory of General Relativity. (4 pts) Explain the major characteristics/properties of Pulsars.

6. The following sequences are mutations of the template sequence in question 1. For each mutated...

6. The following sequences are mutations of the template sequence in question 1. For each mutated sequence, indicate the new amino acid sequence produced and the type of mutation that is the end result in the amino acid (frameshift, Missense, nonsense, silent) as well as the type of mutation that occurred in the DNA sequence (substitution, addition, deletion) Template sequence question 1: 3’ TACCCTGGTGGTTTGCGGACT 5’ a. 3’ TAC CCG GTG GTT TGC GGACT 5’ b. 3’ TAC ACT GGTGGTTTGCGGACT 5’...

6) (8 pts, 4 pts each) State the order of each ODE, then classify each of...

6) (8 pts, 4 pts each) State the order of each ODE, then classify each of them as linear/nonlinear, homogeneous/inhomogeneous, and autonomous/nonautonomous. A) Unforced Pendulum: θ′′ + γ θ′ + ω^2sin θ = 0 B) Simple RLC Circuit with a 9V Battery: Lq′′ + Rq′ +(1/c)q = 9 7) (8 pts) Find all critical points for the given DE, draw a phase line for the system, then state the stability of each critical point. Logistic Equation: y′ = ry(1 −...

Questions 6: Gene Expression Regulation (9 pts) Heart defects from genetically inherited mutations affect about 1-2%...

Questions 6: Gene Expression Regulation (9 pts) Heart defects from genetically inherited mutations affect about 1-2% of children and cause a significant number of stillbirths. They can also lead to heart disease in adults. Many genetically inherited heart defects are due to mutations in genes for transcription factors that control expression of genes that are required for normal heart development. For example, over 30 different mutations have been found in the gene for transcription factor Tbx5 in patients with genetically...

(6 pts) Several mutations of the lac operon have been identified. A bacterial mutant called OC...

(6 pts) Several mutations of the lac operon have been identified. A bacterial mutant called OC (for constitutive operator) expresses the lac operon even when lactose is present, hence the name constitutive operator. What kind of mutation in the operator sequence could lead to a constitutive operator? Another mutant strain of bacteria called Is (for super repressor) leads to repression of the lac operon regardless of the presence or absence of lactose. What kind of mutation in the repressor protein...

1. Predict the effects of the following mutations on the ability of a cell to undergo...

1. Predict the effects of the following mutations on the ability of a cell to undergo apoptosis: (i) Mutation in Bad such that it cannot be phosphorylated by protein kinase B (PKB) (ii) Overexpression of Bcl-2 (iii) Mutation in Bax such that it cannot form homodimers. 2. One common characteristic of cancer cells is a loss of function in the apoptotic pathway. Which of the mutations listed above might you expect to find in some cancer cells?

6. (Each part is worth 2 pts.) A new project that is being considered requires an...

6. (Each part is worth 2 pts.) A new project that is being considered requires an initial investment of $375,000. The expected future cash flows are $250,000 per year for four years. Assume the appropriate discount rate is 15%. a. What is the NPV? b. Suppose that the firm that’s considering this project has a market value of $2.2 million. If the firm accepts this project, what will be the firm’s new market value? c. What is the IRR? d....

9. (6 pts) What are outliers? Describe the effects of outliers on the mean, median, and...

9. (6 pts) What are outliers? Describe the effects of outliers on the mean, median, and mode.

Describe each of the below mutations AND provide an example of each. Behavioral mutations Regulatory mutations...

Describe each of the below mutations AND provide an example of each. Behavioral mutations Regulatory mutations Lethal mutation Conditional mutation Neutral mutation

Question