Digestion Essay Question (10 pts) A. What effects would result from surgical removal of each of...

Digestion Essay Question (10 pts)

A. What effects would result from surgical removal of each of the following? (6 pts)

• Stomach

• Gall bladder

• Pancreas

B. Removal of which one would have the biggest impact on digestion? The smallest impact? Explain your reasoning. (4 pts)

Expert Solution

A)

- Gastrectomy or surgical removal of a part or whole stomach may lead to a condition known as dumping syndrome. The swallowed food reaches the intestine quickly and this may leads to problems like nausea, diarrhea, flushing and sweating after eating. There will be a feeling of fullness even after consuming a small quantity food. Weight loss and vitamin B12 deficiency may also be seen.

- Cholecystectomy or removal of gallery bladder, may produce digestive symptoms like fat indigestion, diarrhea flatulence and constipation.

- Pancreatectomy is the complete or partial removal of pancreas. It interfere with digestion of food and also blood glucose levels. There may be indigestion, heartburn, diarrhea, constipation, diabetes or hyperglycemia is also seen.

B) the largest impact on the digestive system would be Pancreatectomy. Digestive enzymes and artificial insulin will have to be provided in order to have a normal life. Smallest impact would be Gastrectomy, as the storage and breakdown function of the stomach will be taken over by the intestines. Protein metabolism will also be carried out in the small intestine. A Cholecystectomy on the other hand will impact fat metabolism and hence fat consumption will have to be regulated.

Sydney Mullin answered 1 year ago

A. What effects would result from surgical removal of each of the following? (6 pts) •...

A. What effects would result from surgical removal of each of the following? (6 pts) • Stomach • Gall bladder • Pancreas B. Removal of which one would have the biggest impact on digestion? The smallest impact? Explain your reasoning.

Short Essay Question - GDP (10 pts) Note: This question on the test will be graded...

Short Essay Question - GDP (10 pts) Note: This question on the test will be graded manually. One of the key macroeconomic variables that you have studied in this course is gross domestic product (GDP). This macroeconomic variable has been in the economic news headlines frequently here in the US and around the world during this current global COVID-19 pandemic. As data are collected and early estimates of GDP released, we do not yet know the full extent to which...

Does surgical fat removal or reshaping have permanent effects? Provide your opinion about the surgical fat...

Does surgical fat removal or reshaping have permanent effects? Provide your opinion about the surgical fat removal (liposuction)

Flag this Question Question 12 pts All of this week's Essay Questions will be based on...

Flag this Question Question 12 pts All of this week's Essay Questions will be based on the following scenario: Imagine that you are a marine biologist. On an expedition, you find a reddish brown organism floating in one of your nets (pictured below). It has structures resembling leaves and stems. You hypothesize that this is a photosynthetic organism. Describe how you could test this hypothesis using a pH indicator solution. Carefully describe the steps you would take, the reactants required,...

2. (6 pts) Speculate on the effects of each of the following mutations on the translation...

2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way. (GpppG is the 5’ cap) 5’GpppGUAACAUGGUCGGACCAUGAC(A)2003’ Mutation that removes the editing pocket from isoleucine-tRNA synthetase. Mutation that prevents GTP hydrolysis of eEF1-a. Mutation that prevents binding of GTP by eEF2.

Question 10 (5 pts.): Why do you think cholera would choose to colonize the intestines of...

Question 10 (5 pts.): Why do you think cholera would choose to colonize the intestines of its host, as opposed to other parts of the body? (Try to think about what the bacteria might gain from living in the intestines.) Question 11 (5 pts.): Why do you think it is important for V. cholerae to attach themselves firmly to the epithelial cells of the intestines, as shown in the picture above? Question 12 (5 pts.): Suggest a reason why V....

(10 pts) Draw the result of hashing 11, 22, 3, and 43 into a table using...

(10 pts) Draw the result of hashing 11, 22, 3, and 43 into a table using the following hash function, using separate chaining: h(x) = x % 4 0 1 2 3 (10 pts) Draw the result of hashing 11, 22, 3, and 43 into a table using the following hash function, using open addressing with linear probing: h(x) = x % 4 0 1 2 3

Explain the questions detailed. 10 pts each 1. In which compartment you would find a low...

Explain the questions detailed. 10 pts each 1. In which compartment you would find a low concentration of both K+ ions and Proteins and why? 2. In a given molecule which are the determinants for its transport through a membrane (active/passive/receptor mediated etc.) ?

In regards to this question about Digestion which statement would be true? Which of the following...

In regards to this question about Digestion which statement would be true? Which of the following statements is true regarding the digestion of a precipitate in its mother liquor? 1. A lengthy digestion is inadvisable because more impurities can become entrapped in the growing crystals. 2. An elevated temperature, during digestion, is used to impede the coagulation of a colloidal precipitate through increased kinetic energy of the solution. 3. Digestion promotes recrystallization of a precipitate, thereby increasing particle size and...

Question 21 2 pts Competitive advantage normally is the result of superiority in resources, skills, or...

Question 21 2 pts Competitive advantage normally is the result of superiority in resources, skills, or consistency. feasibility. position. employees. governance. Flag this Question Question 22 2 pts Which of the following is NOT included in measuring organizational performance? Investigating deviations from plans Evaluating individual performance Examining progress being made toward meeting stated objectives Comparing results to competitors' expectations Comparing expected results to actual results Flag this Question Question 23 2 pts The Fortune 50 includes all of the following...

Question