Questions
Define and give examples of convergent evolution • Use a phylogenetic tree to summarize the evolutionary...

Define and give examples of convergent evolution

• Use a phylogenetic tree to summarize the evolutionary relationships among vertebrates

• Identify the main characteristics of each major vertebrate group (fish, amphibians, reptiles, birds, mammals)

• List the four types of tissues that occur in all vertebrate bodies and summarize their functions

In: Biology

1.) Which bacteria grew in the widest range of temperatures? a.) P.fluorescens b.) B. gloibporus c.)...

1.) Which bacteria grew in the widest range of temperatures?

a.) P.fluorescens

b.) B. gloibporus

c.) B. stearothermophilus

d.) E. oli

2.) Which of the following bacteria gre best at the lowest osmotic pressure?

a.) S.ruber

b.) E. coli

c.) S. aureus

d.) V. costicola

3.) Which statement explains what aerobes use oxygen to do?

a.) to insulate themselves in anaerobic enviroments

b.) to prevent free radicals from reacting with DNA and other vital molecules

c.) to provide the alcohol group added to organic compounds in fermentation

d.) to oxidize organic compounds for the release of energy and/or as a terminal electron acceptor

In: Biology

Come up with the best Genus species of bacteria for each case. Given the following description:...

Come up with the best Genus species of bacteria for each case. Given the following description:

Gram (+) cocci arranged in grape-like clusters

Non-spore former

Produced the enzyme catalase

Beta-Hemolytic

Produces the enzyme coagulase

Acid from mannitol

Yellow-gold colony pigment

Novobiocin sensitive

Options are Micrococcus, Planococcus, or Staphyloccus.

Explain the morphology, physiology and virulence factors.

In: Biology

Explain how protists fit into the phylogenetic tree of life Identify the basic structures common to...

Explain how protists fit into the phylogenetic tree of life

Identify the basic structures common to fungi, including: cell walls, hyphae/mycelium, and spores

Give an overview of the haploid/diploid life cycle of fungi and compare to the haploid/diploid cycle in animals

Describe the following symbiotic relationships of fungi and their ecological impacts: • Mycorrhizae • Lichens • Parasitic/pathogenic fungi

In: Biology

Define the term mycosis, and differentiate between systemic mycosis, subcutaneous mycosis, and superficial mycosis. If a...

  1. Define the term mycosis, and differentiate between systemic mycosis, subcutaneous mycosis, and superficial mycosis. If a person contracted a fungal disease that was caused by the group of fungi known as dermatophytes, what type of mycosis would this be? Why is this group of fungi able to cause this type of infection and how it is usually transmitted?

In: Biology

Tristan is a lively little boy who attends daily day-care. He has severe allergies so his...

Tristan is a lively little boy who attends daily day-care. He has severe allergies so his parents have not allo to receive the usual childhood vaccination series for fear of a severe reaction. For the last few days he has ha & swollen throat, fever & won't eat. Inside his mouth a greyish slime, a type of membrane, can be seen at the his throat . His parents take him to Urgent Care . 1. What's your disease diagnosis ? 2. What treatment should be used to combat the effects of toxemia? 3. Why would this tx be a particular challenge for this little boy?

In: Biology

Describe how graded potentials are regulated and how they regulate action potential firing. In your answer,...

Describe how graded potentials are regulated and how they regulate action potential firing. In your answer, specifically identify where on a neuron each event occurs.

In: Biology

Directions: Identify the restriction sites for each of the examples given. Show the cuts, mention if...

  1. Directions: Identify the restriction sites for each of the examples given. Show the cuts, mention if they are sticky ends or blunt, 5’ overhangs or 3 ‘overhangs and the number of DNA fragments produced and the number of base pairs in each (count the top row).

            Remember: Analyze in the 5’à 3’ direction

1. HindII --- 5' GTC ↓GAC 3'

5' ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3'

3' TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5'

Number of pieces of DNA _______

2. EcoRI --- 5' G ↓AATTC 3'

5' ACG ACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'

3' TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5'

Number of pieces of DNA _______

3. HaeIII --- 5' CC ↓ GG 3'

5' ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3'

3' TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5'

Number of pieces of DNA _______

4. BamI --- 5' CCTAG ↓G 3'

5' ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3'

3' TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5'

Number of pieces of DNA _______

5. HindII --- 5' GTC ↓- GAC 3' and HaeIII --- 5' CC ↓ GG 3'

5' ACGGTCGACACGTATTATTAGTCGACTCCGCCGCCGCCGGTCATCA 3'

3' TGCCAGCTGTGCATAATAATCAGCTGAGGCGGCGGCGGCCAGTAGT 5'

Number of pieces of DNA _______

6.   HindII --- 5' GTC ↓ GAC 3', HaeIII --- 5' CC ↓ GG 3' and BamI --- 5' CCTAG ↓ G 3'

5' ACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCG CCCCTAGGGTCATCA 3'

3' TGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5'

Number of pieces of DNA _______

In: Biology

Uncontrolled cell division is a feature of cancer which can result from chromosomal translocations. Discuss with...

Uncontrolled cell division is a feature of cancer which can result from chromosomal translocations. Discuss with examples. 2 pages min please.

In: Biology

Name five common characteristics of protein-coding genes and the regions surrounding them. Why is prediction of...

Name five common characteristics of protein-coding genes and the regions surrounding them.

Why is prediction of eukaryotic genes more complex than prediction of prokaryotic genes?

In: Biology

2.    List and explain one beneficial effect and one detrimental effect of bacteria. (5 marks)

2.    List and explain one beneficial effect and one detrimental effect of bacteria.

In: Biology

What is the effect of point mutations in DNA on proteins? How does this relate to...

What is the effect of point mutations in DNA on proteins?

How does this relate to phenotypic variation, genotypes and alleles?

Answer in 4-5 sentences giving a REAL example of such a mutation.  

In: Biology

What are strengths and weaknesses of each of the major types of epidemiologic study? -Randomized controlled...

What are strengths and weaknesses of each of the major types of epidemiologic study?

-Randomized controlled trial

– Cohort

– Case-control

In: Biology

Discuss the adaptations that have enabled flowering plants to overcome the following problems associated with life...

Discuss the adaptations that have enabled flowering plants to overcome the following problems associated with life on land. a. The absence of an aquatic environment for reproduction b. The absence of an aquatic environment to support the plant body c. Dehydration of the plant

In: Biology

6) What is climate change and what we should do about it? You need to describe...

6) What is climate change and what we should do about it? You need to describe how humans have been impacting on the atmosphere, greenhouses effect, carbon footprint, and climate change impact on biodiversity. (This is an essay question for Biology 1000. Please be sure of your answer and I'll rate high!)

In: Biology