Match each term with its definition.

cytoskelecton

golgi apparatus

ftagella

lysosome

mitoxhondria

extracelluar matrix

nuclear envelop

cell wall

transport vesicle

smooth endoplasmic reticulum

The health of an organism depends on a process that controls the balance of water uptake and loss. This process is called:

Answer:

Enzymes speed up chemical reactions. The scientific term for “speed up” is:

Answer:

The process of water molecules crossing a membrane to the side that has a higher concentration of solute is called:

Answer:

Question text

The sum of all chemical reactions in an organism is called:

Answer:

The process of releasing large molecules to the outside of the cell is called:

Answer:

The following sequence of 30 nucleotides corresponds to one of the two strands of a double stranded DNA:

5’ GATGTGATCAGACCGGGTGCACTCTAATCT 3’

a) This sequence has two perfect palindromes that consist of 6 base pairs each. What is the sequence of these two palindromes?

b) Show both strands of your FIRST palindrome (indicate the 5’-3’ polarity)

c) Show both strands of your SECOND palindrome (indicate the 5’-3’ polarity)

Assume that the two palindromes are recognized by “6-cutter” restriction enzymes, and that each enzyme creates blunt ends. Assuming the 30bp DNA sequence is digested with BOTH enzymes, and that the resulting dsDNA fragments are stable (i.e. the complementary strands remain annealed):

1. How many fragments would you expect upon digestion?
2. How long would these fragments be (in bp)?

1. How is evolution important to current/furture medical practive (for practitioner and patient, with examples)

2. Describe how evolutionary theory allows for a better knowledge about human behavior and how does this impact the understanding of various human behaviors that are diverse (with examples)

3. how does this have value to life. (with examples)

Why do phospholipids form a bilayer in water-based solutions?

1. Which checkpoint and phase of the cell cycle is the expression of BRCA1 and BRCA2 the greatest? What is the function of BRCA1 and why would it make sense that its expression is high at the checkpoint/phase of the cell cycle?

2. Outline the two parts of the eukaryotic cell cycle and describe the three main checkpoints in cell cycle regulation.

*PLEASE ANSWER QUESTIONS AS SIMPLY AS POSSIBLE. I AM IN A BASIC GENETICS COURSE*

*The answers should be completed in a paragraph or less for each question. Please and thank you!*

The promoter region in bacteria is called the -35 and -10 region.

True or False

1. Genetic variation is the difference in DNA sequences between individuals within a population. The human genome has about 3 × 10⁹ base pairs of DNA, and between any two humans, the amount of genetic variation is about 0.1%. In other words, about 1 bp in every 1,000 bp of DNA will be different between two random individuals. Any two individuals have about 6 × 10⁶ base pairs that are different. Therefore, we can say that there is considerable genetic variation in humans and it is important to understand every kind of genetic variation and to develop specialized techniques to analyze these variations. Only then, we can identify and relate these variations with human health and disease.

1. Please consider our whole genome and write and briefly explain every possible type of human genetic variation that you can think of.
2. Choose two variations from part (i) and state two different techniques to identify these two variations. Please explain briefly how these techniques can detect these variations.
3. What may be the effect of genetic variations, if they are found in protein coding regions of genes?

What is the purpose of publishing in a scientific journal?

Discuss the biological efficiencies gained by organizing protein function on a membrane (hint: one critical point is the membrane serving as an interface between environments). Provide an example for each.

What is the difference between SDS-PAGE gel and Native gel and what do you use to visualize migrated proteins?

1.If approximately one in every 2500 white individuals in the united states is affected by the autosomal recessive disease cystic fibrosis, what are the frequencies of both the dominant and recessive alleles in the populations ?

If 14% of individuals in a population have the reseccive phenotype (aa), what percentage of the population is heterozygous ?

I need this answered with a legibale explanation step by step in a simple manner

Please read the two scnarious and answer the questions:

Scenario #1
Ten pea plant seeds were planted in each of 5 pots that contained 500g of “Peat’s Potting Soil.” The pots were given the following amounts of distilled water each day: Pot 1, 50ml; Pot 2, 100ml; Pot 3, 150ml; Pot 4, 200ml; Pot 5, 250ml. According to the pea seed package, the recommended of water for the pea plants was 150ml of water daily. After 40 days, the height of each plant was measured in centimeters.

Scenario #2
Sandy wanted to find out if the color of food would affect whether or not kindergarten children would select it for lunch. She put food coloring into 4 identical bowls of mashed potatoes. The colors were red, green, yellow, blue. One bowl of mashed potatoes was left as the regular white color. Each child was given the choice to choose the bowl of mashed potatoes of the color of their choice. Each day she recorded the choice of 100 different students. She did this for five days.

Title:

Hypothesis:

Independent Variable (IV) :

Description Of Groups :

Repeated Number of Trials

Dependent Variable (DV): Control:

Constants: (minimum of 4)

Repeat or scenario 2

Please discuss about Corona virus what and what is the impact of this word on American culture? What about other cultures? Why is the history of corona virus important for us to understand? What can we gain from this knowledge? Has your research led you to believe this word will grow into something else? What will it grow into and why does that matter?