Complete the following table.

How do poverty, oppression and chronic stress affect diabetes susceptibility? Why do you think so much money and attention goes towards genetic research rather than towards improving social conditions?

An E. Coli strain has the following lac genotype: Lacl+ lacP+ lacOc lacZ- / lacl- lacP+ lacO + lacZ + If lactose is PRESENT, what would the level of Beta-galactose be?

1- High

2- Low

1. The two molecules shown are: A. Epimers B. Identical molecules just drawn differently C. Anomers D. Oligomers C. Enantiomers

2. Sphingomyelins contain more saturated fatty acid tails than glycerophospholipids. A. True B. False 3. What 2 sugars comprise maltose? What kind of bond links the 2 sugars? (open answer) 4. Which of the polysaccharides in the attached figure represents the protective exterior of insects, crabs, etc.?

Inside an angiosperm seed, the embryonic form of the shoot is called the __.

Which of the following are fundamental properties of life: 1) unique macromolecular organization that obeys all of the fundamental laws of chemistry; 2) use of DNA for the storage of genetic information and the eventual production of proteins to allow for organismal development and function; 3) the presence of a hierarchical organization that involves the use of lower levels to build higher levels; 4) spontaneous generation under conditions found in the current biosphere; 5) the interaction with the environment for the acquisition of building blocks and the elimination of wastes; 6) precise cellular movements during development that arise from outside of the system itself.

1. None of them are
2. One of them is
3. Three of them are
4. Four of them are
5. All of them are

Regarding biotechnology/biomanufacturing/cGMPs/FDA, How is the approval process for drugs and biologics different?

A man heterozygous at both the locus for PTC tasting and at the locus for albinism marries an albino woman heterozygous at the PTC tasting locus. These two loci assort independently. a) what is the probability of producing 3 tasters with normal pigmentation and 3 non-taster albinos in a family of 6 children? b) what is the probability of producing 3 tasters with normal pigmentation and 3 non- taster albinos in that order in a family of 6 children?

Describe at least two elements from a food label of something you currently eat. that you feel will be of great significance in planning a healthy eating plan for yourself, examine the focus panel comparing the old standard FDA mandated food label for most packaged foods with the then-proposed new one. Compare the old to the new one in reality that you are holding. Identify at least two distinctions between your label and the old label in the picture; tell if those distinctions changed in the same way as predicted in the picture or in a different way, and why this might be important. Lastly, regarding the 'Ingredients', do you think in general that a healthier food will have a longer or shorter list? Why?.

For each of the three amphibian groups Caudata, Anura and Gymnophiona

generally summarize how they reproduce (calling? internal? external? eggs? metamorphosis? direct development etc., any parental care?).

8. Large chromosome rearrangements or duplications are a common feature of cancers, but not of inherited genetic traits.

8A. Explain why these types of mutations are not tolerated in live births. 4 pts)

8B. Explain why these types of mutations are common in cancers. (4 pts)

You are planning to use PCR to amplify several regions of a piece of DNA. The sequence of your template DNA is provided below along with the sequences of all available primers. Determine where each of the primers bind and answer the following:

5' AGGGCCAAATGAGATGAGTCAAAAGCTGCCGATAACCGGATAG 3'

3' TCCCGGTTTACTCTACTCAGTTTTCGACGGCTATTGGCCTATC 5'

Primer 1: 5-TTGGCC 3

P2: 5-GTCAAA-3

p3: 5-AACCGG-3

p4: 5-CCGGTT-3

P1 can bind to the bottom strand?

P4 can bind to the molecule at only one location

Which primer pair would you use to amplify a double stranded pcr fragment of any size from this template

Which primer has the lowest melting point

Using the two selected primers and added all of the PCR components to a test tube answer the following as the polymerase chain rxn proceeds

The concentration of dNTPs will increase,decrease, stay the same, as the rxn proceeds

The concentration of Taq DNA polymerase will increase,decrease, stay the same, as the rxn proceeds

Define selective agar
Explain in detail how SS agar is selective.
SSA is also a differential agar.
Define differential agar
Explain in detail the two way that SS agar is differential.
Describe the colonies of the following bacteria species:
Salmonella -
Shigella -
Proteus -
E. Coli –

Describe the pathway of a H2O molecule from the soil solution from its absorption by a root hair to its exit to the atmosphere from a stomate 100 meters above the forest floor. Be sure to mention all tissues and cell types that it may pass through, their significance, as well as any relevant physical forces acting upon it.

1. Which of the following statements about beta diversity is TRUE?

A. Beta diversity does not change when you measure it at different scales

B. All else being equal, generalists are more likely to be common when beta diversity is high

C. Homogenous landscapes tend to have high beta diversity

D. Topographically diverse, heterogenous landscapes tend to have high beta diversity

2.

Which of the following statements about species-accumulation curves is TRUE?

A. Only gamma diversity can be estimated using species-accumulation curves

B. Species-accumulation curves are a technique to estimate alpha diversity of a relatively homogenous site

C. Species richness will be estimated correctly using species-accumulation curves even if there are only a few samples

D. The order in which samples are processed will not affect the precise shape of species-accumulation curve