Defend why synapomorphy constitutes te best evidence for monophyly and why monophyletic groups are the only groups that should be represented in a classification system. Use an example of a well known group name that has been rendered non-monophyletic via phylogenetic classification methods.

what type of mutation causes cancer? and how does it cause cancer?

What proteins might be most likely to co-purify with Con A during affinity chromatography on Sephadex?

Why is a V vs S plot often inadequate for determining enzyme kinetic constants, and how do various alternate plotting methods allow these values to be determined more adequately? Give examples of alternate methods of kinetic analysis and their utility.

The V vs S plot is inadequate because it makes the assumption that it’s only for a single subunit and substrate. The line on the graph usually represents a line that best fits the data and are not completely accurate. This only measures free enzymes or unstable enzyme substrate complex. An alternate method

Read the article (link is below) and answer the questions that follow in a paper format. (Paper has to be 1-page, 11-inch font- single-spaced). I already did #1, please I need help with 2 & 3. The article is super confusing. COPY THE BELOW LINK AND PASTE IN YOUR BROWSER

https://www.researchgate.net/publication/50596700_A_long_noncoding_RNA_maintains_active_chromatin_to_coordinate_homeotic_gene_expression

Primary Paper HW assignment guidelines

Your primary paper consists of three parts:

1. In your own words, state the essential take home message of the paper assigned.

-Here you should briefly mention what was known about this topic before this paper was published

-Then state what the aim/goal/purpose of this published study was. In other words, what did the authors set out to do?

-Also describe why this research is important (if you think it is important)/ what are the researchers hoping to contribute to the existing knowledge.

2. State how the authors demonstrated the essential point of the paper: what experiments and what methods they used to prove the point

-In this section you should link how a particular approach/method was used to obtain a particular result and why it would be important/relevant. For example:

-Authors used method A to get/show result B. Result B is important because (it supports their original hypothesis in the following way/describe how/ or it provides novel findings regarding mechanism X

-Continue the bulleted list to correlate specific method with specific result and how it supports the claims made in the paper.

3. Discuss the strengths and significance of the paper and also the weaknesses and indicate additional lines of investigation that you think would be worth pursuing that were opened up by the paper.

-Here I want you to critique the experimental approach and author’s conclusions, not their writing style or format of the paper. Also, keep in mind that these are primary research articles published in scientific journals, so they are intended for a scientific, not general audience. Hence the language could be a bit dense.

-I want you to be very specific here. Do not write general and vague statements. Instead, refer to specific data in the paper (in figure X, or table Y) and indicate any possible flaws or limitations of the experiment.

-Propose possible future directions or follow up studies. You can look up papers that cited this research or follow up on the last author’s subsequent research.

-Explain if this paper contributed anything new to the field and if it enabled better understanding of the subject

Why would the adaptive immune system be more effective than the innate system to fight off Pertussis?

How memebers of Dyslexia suffer because of the wrongful assumptions made about them? Please focus on peer persecution and discrimination at learning institutions.

Would a reference laboratory get involved with a transfusion reaction work up?

If a person has alloantibody that cannot be identify, would it be sent it out? If so, what techniques would the reference laboratory use to identify it?

What happens to chlorophyll a from the light harvesting complex after absorbing light? What happens to chlorophyll a from the reaction center after absorbing light?

Chapter 9: CENTRAL NERVOUS SYSTEM

a) What are gray and white matter composed of in the CNS?

b) What are clusters of cell bodies called if they are located in the CNS? How about the PNS? What are bundles of axons called in the CNS? How about the PNS?

c) What are the three meninges? Describe their functions and relative locations.

d) What two fluids make up the extracellular environment in the brain?

e) Describe where cerebrospinal fluid is produced, where it flows and where it is reabsorbed.

f) Describe what the blood-brain barrier is. How can it select what passes and what does not? What freely passes across the blood-brain barrier? How does the blood-brain barrier affect clinical treatment of brain diseases?

g) Describe why diabetics who are hyperglycemic frequently suffer from hypoglycemic shock.

h) Describe the 6 main brain regions. Include their major functions and any structures housed within them.

i.) Describe the highly organized structure AND function of the cortex (why is the brain furrowed?)

j) What are the limbic system and reticular formation?

k) What are the four diffuse modulating systems (refer to book)? How are they named/characterized? What happens when there are deficiencies in communication within the system?

l) Describe the hypotheses for why we sleep. What are the benefits of REM vs deep (stage 4) cycles of sleep?

m) Describe Process S and C, and how the balance between them both drives sleep and wakefulness.

n) How is mood different than emotion?

o) What is one common cause for depression and give one example for how it can be clinically treated?

Discuss the burden of disease caused by communicable diseases and provide an example.

Discuss the criteria that are used to establish that an organism is a contributory cause of a disease

Discuss the factors that affect the transmissibility of a disease and provide an example

Discuss the roles that barrier protections play in preventing communicable diseases and provide an example

Discuss the roles that vaccinations can play in preventing communicable diseases and provide an example

Discuss the roles that screening, case finding, and contact treatment can play in preventing communicable diseases

Discuss the conditions that make eradication of a disease feasible

Discuss a range of options for controlling the HIV/AIDS epidemic and provide an example

Course - Public health

1. Explain how RNAi could be used to treat disease.

2. What are two specific ways in which RNAi can block the production of proteins.

3. RNAi exerts its effect by mainly controlling which process?

a. Termination

b. Translation

c. Transcription

d. Replication

e. Splicing

4. Which of the following is not true about miRNA?

a. One miRNA may match multiple targets

b. miRNA is used by scientist as a therapy

c. miRNA is found in plants and animals

d. miRNA is a product of a gene

5. An RNA molecule that loops to base pair with itself is called a.............. RNA because of its characteristic shape.

6. Suppose that you wish to target a gene using siRNA. The sense strand of the gene that is the DNA strand codes for the mRNA contains 21 base sequence: 5' TCGGAGCAAATAGGTAGGCA 3' What would be the most appropriate 21 base guide strand sequence that would target the mRNA?