Question

In: Other

Explain “Why foam fracturing is more popular in shale gas production systems”?. Also, mention three examples...

Explain “Why foam fracturing is more popular in shale gas production systems”?.
Also, mention three examples where foam fracturing is done?
Minimum 500 words

Solutions

Expert Solution

Foam fracturing is highly popular due to low viscosity which is able to the ends of the fracture. It also has high proppant carrying capacity that reduces water consumption and chemical uses and facilitates quick and easy fluid flow back. Foam fracturing techniques reduces overall pumping and operating cost due to its low viscosity. The viscosity and density of foam-based fluids have 250 kg/ m3 and 0.15 Pa.s. which is nearly 1/4 the of the density and 1/3 rd of the viscosity of fracturing fluid. Another advantage of foam fracturing is it's reduced water usage, reduced wastewater generation, reduce formation damage, higher proppant capacity and it's recyclable or reusability. Foam fracturing techniques are also highly environmentally friendly and it minimises the overall environmental damage. Various foam generating materials like nitrogen, CO2 with water, acid or alcohol are effectively utilized. Slick water fracturing created micro-fractures that enhance shale gas production.

Foam fracturing is tried at various places like Devonian shale in Youngstown USA, Jackson county, lower iron shale fairway the USA and Cenomanian formation in western Siberia.

The examples of foam fracturing are water-based foam fracturing (water + foaming surfactant + N2 or CO2), acid-based foam fracturing (acid + foaming surfactant + N2 has) and alcohol based foam fracturing (methanol + foaming surfactant + N2 ). All these methods are used in low pressure formulations, low pressure water sensitive formulations and low pressure formulation with water blocking case respectively.


Related Solutions

Explain the three levels in the planning process and give an example for each. Also mention...
Explain the three levels in the planning process and give an example for each. Also mention how they are linked with each other and why planning is important for each of the three levels of management.
Explain why activity-based costing is becoming more popular.
Explain why activity-based costing is becoming more popular.
Using three examples for two body systems, explain the physiological concept of structure function relationships -...
Using three examples for two body systems, explain the physiological concept of structure function relationships - structure enables function
Non financial performance indicators (NFPI's) are becoming more popular when measuring performance. Explain why that this...
Non financial performance indicators (NFPI's) are becoming more popular when measuring performance. Explain why that this is the case.
Why do we find more product variety in larger cities? Explain with examples.
Why do we find more product variety in larger cities? Explain with examples.
With practical examples, explain why there are more violent crimes in urban than rural areas in...
With practical examples, explain why there are more violent crimes in urban than rural areas in Ghana. How can the growing problem of insecurity in urban Ghana be addressed? give relevant references.
Define fisher effect and explain three reasons why it is also applied to international markets.
Define fisher effect and explain three reasons why it is also applied to international markets.
Give three examples of engineered products that must be circular in shape and explain why
Give three examples of engineered products that must be circular in shape and explain why. Any ball is not allowed as an answer!    
Explain, in your own words, why the production possibilities frontier (PPF) is a downward-sloping curve. Also,...
Explain, in your own words, why the production possibilities frontier (PPF) is a downward-sloping curve. Also, explain why all points inside of that curve represent inefficient outcomes. Draw a market which you believe would represent the market for a cure to the current Coronavirus. Draw and explain what would happen to this market if an announcement was made that indicated the number of confirmed cases doubled over the weekend.        3. As an extension of #3, how would the approval...
1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions....
1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions. 2. You want to amplify at least the underlined sequence, you can have some flanking sequence as well.       5’CTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG 3’ Design the most optimal primers according to Tm and length. Write out each primer and show which is the 5’ and 3’ end of each primer. How big will your PCR product be? 3.. What are the differences between covalent bonds and non-covalent...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT