Question

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions.

2. You want to amplify at least the underlined sequence, you can have some flanking sequence as well.

      5’CTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG 3’

Design the most optimal primers according to Tm and length. Write out each primer and show which is the 5’ and 3’ end of each primer.

How big will your PCR product be?

3.. What are the differences between covalent bonds and non-covalent bonds? Where are each found?

Answer 1

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions.

Hydrophobic interaction of quaternary structure of protein folding

Van der Waals (dispersion) forces contribute to interactions of proteins with other molecules or with surfaces, occurs between non polar amino acids in the primary structure

Hydrogen bonds are relatively weak interactions, for biological macromolecules such as DNA and proteins.

2.          5' GGG TCA CGA GCA TCA GCA CGC AAG 3'   - forward primer

              3' ATC GCT AGC GCT AGA ATA TCG CAT 5' - reverse primer

            Product size = 126 base pairs

3.. What are the differences between covalent bonds and non-covalent bonds? Where are each found?

noncovalent bonds are ionic bonds cause transfer of electrons, critical in maintaining the three-dimensional structures of large molecules such as proteins and nucleic acids

Covalent interactions cause sharing of electrons establish the structural framework of the protein molecule, the chemical expression of primary structure backbone conformation