Question

In: Biology

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions....

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions.

2. You want to amplify at least the underlined sequence, you can have some flanking sequence as well.

      5’CTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG 3’

Design the most optimal primers according to Tm and length. Write out each primer and show which is the 5’ and 3’ end of each primer.

How big will your PCR product be?

3.. What are the differences between covalent bonds and non-covalent bonds? Where are each found?

Solutions

Expert Solution

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions.

Hydrophobic interaction of quaternary structure of protein folding

Van der Waals (dispersion) forces contribute to interactions of proteins with other molecules or with surfaces, occurs between non polar amino acids in the primary structure

Hydrogen bonds are relatively weak interactions, for biological macromolecules such as DNA and proteins.

2.          5' GGG TCA CGA GCA TCA GCA CGC AAG 3'   - forward primer

              3' ATC GCT AGC GCT AGA ATA TCG CAT 5' - reverse primer

            Product size = 126 base pairs

3.. What are the differences between covalent bonds and non-covalent bonds? Where are each found?

noncovalent bonds are ionic bonds cause transfer of electrons, critical in maintaining the three-dimensional structures of large molecules such as proteins and nucleic acids

Covalent interactions cause sharing of electrons establish the structural framework of the protein molecule, the chemical expression of primary structure backbone conformation


Related Solutions

What type of interactions are important and prevalent in biological systems? Non-covalent or Covalent? Please explain...
What type of interactions are important and prevalent in biological systems? Non-covalent or Covalent? Please explain your choice. Can you provide examples of both these types of interactions in the context of protein structure that you learned.
Using your knowledge of the main types of non-covalent interactions that occur in biological chemistry, discuss...
Using your knowledge of the main types of non-covalent interactions that occur in biological chemistry, discuss the spontaneous assembly of the four main types of biological structure with stable structures: DNA, proteins, glycans (such as cellulose and chitin) and cell membranes. Compare and contrast the various structures in terms of the forces and chemical structures driving their assembly. Finally, discuss why their particular molecular structures allow them to perform their biological roles.
In the following diagram, solid lines represent covalent bonds while dotted lines represent non-covalent interactions. Which...
In the following diagram, solid lines represent covalent bonds while dotted lines represent non-covalent interactions. Which of the depictions of molecules show a hydrogen bonding interaction. Check all systems that apply. Consult Textbook Your Answers:      H—H —N‧‧‧‧‧H—O— —C‧‧‧‧‧H—F— —O‧‧‧‧‧H—C— Submit Feedback: Question 14 Identify which of the following molecules have a net dipole moment: Consult Textbook Your Answers: CCl4 CH2Cl2 (CH3)2O CO2 BF3 Submit Feedback: Question 15 Determine the predominant intermolecular force in each of the following substances: Consult Textbook...
1. List all the chemical bonds and interactions. Give at least one example for each. Make...
1. List all the chemical bonds and interactions. Give at least one example for each. Make sure to include a biological molecule in the examples. Draw four molecules which shows polar and nonpolar covalent bond, H-bond and ionic bond.
1. Types of Bonds. Are the bonds in each of the following ionic, non-polar covalent, or...
1. Types of Bonds. Are the bonds in each of the following ionic, non-polar covalent, or polar covalent? Arrange the substances with polar bonds in order of increasing bond polarity. a. KBr (s) b. S8 (s) c. HCl (g) d. Cl2 (g) e. CO (g)
1. List at least three examples that fit the definition of aggression, and at least one...
1. List at least three examples that fit the definition of aggression, and at least one that does not.  (Examples can be hypothetical or real) 2. Why do people deny the harmful effects of violent media when the research evidence linking violent media to aggression is so conclusive? 3. Consider the various causes of aggression described in this module and elsewhere, and discuss whether they can be changed to reduce aggression, and if so how
1. What non-covalent interactions can (1) Alanine and (2) Threonine acid participate in, as part of...
1. What non-covalent interactions can (1) Alanine and (2) Threonine acid participate in, as part of tertiary structure at pH 7? Include an explanation of the charges involved (full or partial, permanent or temporary)? 2. Suggest one amino acid whose side chain can participate in a non-covalent interaction with the side chain of alanine, and one amino acid whose side chain can participate in a non-covalent interaction with the side chain of threonine.
describe the chemical nature of the non-covalent bonding interactions between peptides and lipids.
describe the chemical nature of the non-covalent bonding interactions between peptides and lipids.
what are three examples of a professional development plan? why is it important to network? list...
what are three examples of a professional development plan? why is it important to network? list 2 reasons
Name and thoroughly discuss the 4 non-covalent interactions that are responsible for stabilizing the secondary structures...
Name and thoroughly discuss the 4 non-covalent interactions that are responsible for stabilizing the secondary structures of proteins?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT