. The primary transcript (pre-mRNA) of a nuclear gene in chimpanzee has the sequence: 5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’...

. The primary transcript (pre-mRNA) of a nuclear gene in chimpanzee has the sequence:

5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’

After the intron has been removed, what is the likely sequence of the mRNA?

Solutions

Expert Solution

The resulting mature mRNA will have the following sequence:

5’-G-exon1 –AGGUC-exon 2-A-3’

Eukaryotic transcription for mRNA does not directly forms mature mRNA, rather pre-mRNA is formed first which undergo post transcriptional modifications to make mature mRNA. Post transcriptional modification includes three steps: 5' capping, 3' polyadenylation and splicing of introns. (Remember introns are not included in the mature mRNA).

In eukaryotic protein-coding genes, two types of introns are found : (1) GU-AG and (2) AU-AC.

The present sequence { 5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’ } seems to have GU-AG type of introns due to the presence of -GU- towards 5' end of intron and -AG- towards 3' end of intron (as shown below in red color font)

5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’

An internal adenosine nucleotide (shown in blue color above), starts a transesterification reaction and results in breakage of phosphodiester bond at 5' splice site (i.e., 5'-GU-3') forming a lariat structure. A second transesterification reaction cleaves the 3'splice site (i.e., 5' -AG-3') and thw two exons join with each other.

The resulting mature mRNA will have the following sequence:

5’-G-exon1 –AGGUC-exon 2-A-3’

gladiator answered 1 year ago

Next > < Previous

Related Solutions

5'-tatctatggcatggcgatcatagaggcgtg-3' 3'-atagataccgtaccgctagtatctccgcac-5’ a. Write the mRNA sequence for this gene. Be sure to label the 5’...

5'-tatctatggcatggcgatcatagaggcgtg-3' 3'-atagataccgtaccgctagtatctccgcac-5’ a. Write the mRNA sequence for this gene. Be sure to label the 5’ and 3’ ends. (2 pts.) c. Circle the start and stop codons in the sequence you wrote in b. (2 pts.) d. Write the protein sequence translated for this gene. (2 pts.) e. The anticodon of the tRNA which carries the last amino acid will be: ____________ (2 pts.) 2. Write one sentence using the words promoter, transcription factors and RNA polymerase to describe...

An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and...

An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and nontemplate strands of the gene encoding this mRNA. Clearly indicate which is which and include 5’ and 3’ polarity. Change the font (where it says paragraph above) to "preformatted" to get a constant-width font the will make your sequence more readable. (3 pts) Use the genetic code to write the N to C sequence of the protein specified by this RNA. Remember that the...

Why can’t the 3’ end of pre-mRNA be modified at the same time as the 5’...

Why can’t the 3’ end of pre-mRNA be modified at the same time as the 5’ cap is place on the other end?

2) What are Processing of Eukaryotic Pre-mRNA . A) How is the 5´-Cap added to nascent...

2) What are Processing of Eukaryotic Pre-mRNA . A) How is the 5´-Cap added to nascent RNAs? B) What proteins are involved in polyadenylation? Indicate their order of association with premRNA and their functions.

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is...

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is shown) The gene has undergone a mutation. The mutant DNA/gene has the base sequence: 5’GTACTCCAT3’ (the mutation is in BOLD) based on this information, answer the following 1a)What is the base sequence of mutant mRNA? Label the ends of the mRNA 1b) this mutation is most likely to be caused by: a. soot b. analogues c. X-Ray d. RNA polymerase e. ribosome (pick one)...

If all 5' and 3' splice sites were always used to process the pre-mRNA into mRNA, how many possible distinct mRNA sequences would result from this processing?

The primary sequence of the peptide listed below. H2N -(1) - (2) - (3) - (4)...

The primary sequence of the peptide listed below. H2N -(1) - (2) - (3) - (4) - COOH H2N - Asp-Thr-Phe-Lys-COOH H2N – D -T – F – K – COOH Use the one letter amino acid code and identify from N-terminus to C-terminus. a.Determine the pI of the peptide. (Round to 2 decimal points) b. Would mutating residue #3 to Ala change the pI of the peptide? Explain. c. Which type of noncovalent interaction would the indicated residue side...

Eukaryotic mRNA has both a 5’ cap and a 3’ poly(A) tail.How are they produced?

2. The -10 core promoter of the lac operon gene has the sequence TATGTT. Describe an...

2. The -10 core promoter of the lac operon gene has the sequence TATGTT. Describe an example of a base substitution mutation which would lead to increase transcription of the gene. Explain whether this mutation would increase or decrease the fitness of the organisms.

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?

Subjects