Why can’t the 3’ end of pre-mRNA be modified at the same time as the 5’...

Why can’t the 3’ end of pre-mRNA be modified at the same time as the 5’ cap is place on the other end?

Solutions

Expert Solution

The pre-mRNA synthesized in the nucleus has to be transported into the cytoplasm in eukaryotes. Pre-mRNA undergoes post-transcriptional processing and forms mature mRNA which then enters the cytoplasm for translation. Post-transcriptional processing includes 5’ capping, 3’ polyadenylation and alternative splicing of introns.

Very early during transcription by RNA pol II, a 5’ m7G Cap is added to 5’ end of the mRNA. mRNA transcription occurs in 5’ to 3’ direction. The 5’ cap is added when the pre-mRNA is 20 nucleotides long. This cap is required for protein translation as it is recognize by eukaryotic translation initiation factor eIF-4E. However, it has functions even before translation. It is required for alternative splicing of introns, and also essential for processing the 3’ end of the pre-mRNA. It also helps in export of mature mRNA to the cytoplasm. It protects the mRNA from actions of 5’ to 3’ exonucleases.

The 3’ poly A tails is added only after complete pre-mRNA is formed. It protects the mRNA from degradation and allows its stable translocation to cytoplasm. Histone pre-mRNA lack poly A tail. Poly A tail helps in protein translation.

Thus, 5’ Cap and 3’ poly A tail are added at different times on pre-mRNA formation. The 5’ Cap is required for processing of 3’ end of the pre-mRNA. The cap binding complex CBC, which binds to the cap, is required for the endonucleolytic cleavage step of polyadenylation. Thus, polyadenylation cannot occur if the 5’ capping has not occurred previously. Cap also is involved in termination of transcription and exosomal degradation. If capping has not occurred, then the polyadenylation will also fail. 5’ Capping has important role in transcription and post transcriptional processing of mRNA while 3’ poly A tail mostly have role in post-transcriptional processing. This is the reason 5’ capping occurs much prior to 3’ poly A tail addition, in eukaryotes. 5' Cap should already be added before poly A tail can be added at 3' end.

Sydney Mullin answered 1 year ago

Next > < Previous

Related Solutions

The difference between a pre-mRNA and a mature eukaryotic mRNA is __________. a. the 5' and...

The difference between a pre-mRNA and a mature eukaryotic mRNA is __________. a. the 5' and 3' ends have been modified in mRNA b. the removal of the leader sequence from the pre-mRNA c. the fact that all introns have been spliced out in the mRNA d. Both a and c Which of the following statement is TRUE about transcription? a. Transcription in prokaryotes does not differ from transcription in eukaryotes. b. Prokaryotes carry out transcription in the cytosol, whereas...

If all 5' and 3' splice sites were always used to process the pre-mRNA into mRNA, how many possible distinct mRNA sequences would result from this processing?

2) What are Processing of Eukaryotic Pre-mRNA . A) How is the 5´-Cap added to nascent...

2) What are Processing of Eukaryotic Pre-mRNA . A) How is the 5´-Cap added to nascent RNAs? B) What proteins are involved in polyadenylation? Indicate their order of association with premRNA and their functions.

. The primary transcript (pre-mRNA) of a nuclear gene in chimpanzee has the sequence: 5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’...

. The primary transcript (pre-mRNA) of a nuclear gene in chimpanzee has the sequence: 5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’ After the intron has been removed, what is the likely sequence of the mRNA?

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’...

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’ AUCCGACCGU 3’ 5’ TGCCAGCCTA 3’ 5’ UGCCAGCCUA 3’ Answer question a in the first row (with a number). For statements b-k, enter an X to indicate if it is associated with DNA replication, transcription or translation. A statement may apply to more than one. DNA Replication Transcription Translation Number of template DNA strands? ________ ________ N/A Uses DNA polymerase Uses RNA polymerase Requires ribosomes...

Explain the regulation of the trp operon by the 5' end of the mRNA when tryptophan...

Explain the regulation of the trp operon by the 5' end of the mRNA when tryptophan is low vs high.

Describe the 3 steps of pre-mRNA processing for a Eukaryote. For each step, include any relevant...

Describe the 3 steps of pre-mRNA processing for a Eukaryote. For each step, include any relevant enzymes,molecules, and locations within the cell.

5'-tatctatggcatggcgatcatagaggcgtg-3' 3'-atagataccgtaccgctagtatctccgcac-5’ a. Write the mRNA sequence for this gene. Be sure to label the 5’...

5'-tatctatggcatggcgatcatagaggcgtg-3' 3'-atagataccgtaccgctagtatctccgcac-5’ a. Write the mRNA sequence for this gene. Be sure to label the 5’ and 3’ ends. (2 pts.) c. Circle the start and stop codons in the sequence you wrote in b. (2 pts.) d. Write the protein sequence translated for this gene. (2 pts.) e. The anticodon of the tRNA which carries the last amino acid will be: ____________ (2 pts.) 2. Write one sentence using the words promoter, transcription factors and RNA polymerase to describe...

An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and...

An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and nontemplate strands of the gene encoding this mRNA. Clearly indicate which is which and include 5’ and 3’ polarity. Change the font (where it says paragraph above) to "preformatted" to get a constant-width font the will make your sequence more readable. (3 pts) Use the genetic code to write the N to C sequence of the protein specified by this RNA. Remember that the...

Explain why a typical linear regression model can’t be used for time series analysis and describe...

Explain why a typical linear regression model can’t be used for time series analysis and describe an example of a time series

Subjects