Question

In: Psychology

1. Cognitive bias occurs when people exaggerate the probability of very rare events if their consequences...

1.

Cognitive bias occurs when people exaggerate the probability of very rare events if their consequences are catastrophic. How does the availability heuristic enhance this kind of bias?

2.

How does the focus of the cognitive theories of intelligence differ from the focus of psychometric theories? How do the two approaches define intelligence?

3.

One of the longest-running psychological studies ever conducted was begun by Lewis Terman in 1921 in order to learn about children who scored in the top 1 percent of the IQ distribution. As they reached adulthood, some of these "Termites," as they were called, fulfilled their early promise, but others did not. Analyze the differences between those who were successful and those who were not.

Solutions

Expert Solution

Cognitive bias is a tendency to acquire and process information depending on own beliefs, likes/dislikes, previous experiences, etc. It is limitation of ability to process information objectively resulting in perception of subjective reality. This limits reasoning ability, rationale of an individual. Probability refers to likelihood of an event to happen. Example: Probability of seeing sunrise at east is high (100%) and probability of watching a TV show at evening may be uncertain due to many reasons making it low probable event (0% to 50%).

Heuristics refer to shortcuts for problem solving. Usually, heuristics are followed when problem perceived is similar to previous one. Here, rather than reasoning from scratch, individual may use previous experience or adapt others techniques who may have handled similar problem. Availability heuristic is a notion that if we can recall an event or thing quicker and more available in our memory, then the probability of that event is more. Here, individuals give prominence to events that are recent and fresh in memory. In other words, an event has recently is more available in memory and individual tend to perceive probability of this event to happen again is more even though this perception is not objective. Example: An individual who witnessed motor vehicle accident recently in one lane may anxiously think chances of reoccurrence of that event are high even though there is no objective reason for such happening.

Availability heuristics influence individual's cognition to perceive the reality with correlation to recent event rather than perceiving the reality with rationale. Example: If death due to car accidents are more publicized than deaths due to HIV or cancer in nation, then individuals who learn more about deaths due to accidents in media may perceive accidents as major cause of death, even though deaths due to HIV or cancer are high compared to accidents if we check facts and figures. Here, we can observe assumption without verification about cause death. As there is more publicity to accidental deaths, memory of individual's is occupied with assumption of accident as major cause of death. This way availability heuristics enhance cognitive bias in individuals.


Related Solutions

A rare form of malignant tumor occurs in 11 children in a​ million, so its probability...
A rare form of malignant tumor occurs in 11 children in a​ million, so its probability is 0.000011. Four cases of this tumor occurred in a certain​ town, which had 15,359 children. a. Assuming that this tumor occurs as​ usual, find the mean number of cases in groups of 15,359 children. b. Using the unrounded mean from part ​(a​) ,find the probability that the number of tumor cases in a group of 15,359 children is 0 or 1. c. What...
A rare form of malignant tumor occurs in 11 children in a​ million, so its probability...
A rare form of malignant tumor occurs in 11 children in a​ million, so its probability is 0.000011. Four cases of this tumor occurred in a certain​ town, which had 15915 children. a. Assuming that this tumor occurs as​ usual, find the mean number of cases in groups of 15915 children. b. Using the unrounded mean from part ​(a​), find the probability that the number of tumor cases in a group of 15915 children is 0 or 1. c. What...
A rare form of malignant tumor occurs in 11 children in a​ million, so its probability...
A rare form of malignant tumor occurs in 11 children in a​ million, so its probability is 0.000011. Four cases of this tumor occurred in a certain​ town, which had 16,654 children. a. Assuming that this tumor occurs as​ usual, find the mean number of cases in groups of 16,654 children.b. Using the unrounded mean from part ​(a​), find the probability that the number of tumor cases in a group of 16,654 children is 0 or 1. c. What is...
______ is a bias that occurs when a rater consistently rates employees on the higher end...
______ is a bias that occurs when a rater consistently rates employees on the higher end of an evaluation scale. Question 7 options: Recency error Contrast error Strictness error Leniency error Which of the following would not be an employee concern with respect to performance management? Which evaluation approach is used Perceptions of procedural justice Perceptions of distributive justice Achieving work/life balance Question 9 Person analysis is the identification of the gap between (1) the KSAs employees need in order...
1. Please explain how the sequence of events that occurs when a codon that specifies an...
1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site. 2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence: 3’–ACTACACGACAGGCATAATT—5’ (DNA Template) a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)...
describe the correct sequence of events that occurs when the government of a nation that was...
describe the correct sequence of events that occurs when the government of a nation that was originally in equilibrium raises its personal income tax rates. Be sure to mention which curve (AD or SRAS) shifts, which way that curve shifts and the impact that it would have on the nation's price level and Real GDP.
#18 Events A and B are mutually exclusive. Suppose event occurs with probability 0.05 and event...
#18 Events A and B are mutually exclusive. Suppose event occurs with probability 0.05 and event occurs with probability 0.36. a. Compute the probability that B occurs or does not occur (or both). b. Compute the probability that either occurs without occurring or occurs without occurring. (If necessary, consult a list of formulas.) ? #19 Events and are mutually exclusive . Suppose event occurs with probability 0.11 and event B occurs with probability 0.81. If does not occur, what is...
What consequences does a client face when a mishap occurs in a project? Please give a...
What consequences does a client face when a mishap occurs in a project? Please give a detailed answer.
Describe the series of events that occurs when a ligand binds to a receptor tyrosine kinase...
Describe the series of events that occurs when a ligand binds to a receptor tyrosine kinase during cellular signalling, and what occurs once the ligand is removed? Describe the series of events that occurs before and after a ligand binds to a G protein coupled receptor during cellular signalling?
Please explain how the sequence of events that occurs when a codon that specifies an amino...
Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT