Which of the following correctly describes the sequence of events that occurs once a neuron’s threshold...

Which of the following correctly describes the sequence of events that occurs once a neuron’s threshold for forming an action potential is reached?

A. Sodium enters the neuron, followed by potassium leaving the neuron.

B. Sodium enters the neuron at the same time that potassium leaves the neuron.

C. Potassium enters the neuron, followed by sodium leaving the neuron.

D. Potassium enters the neuron at the same time that sodium leaves the neuron

Please explain the answer in 200 words or less.

Solutions

Expert Solution

The "threshold" potential of a membrane is the Minimum depolarization needed to operate the voltage gated sodium and potassium channels.

The convergence of ions isn't static however! Ions are streaming all through the neuron continually as the ions endeavor to adjust their concentrations. The cell however keeps up a genuinely reliable negative fixation gradient (between - 40 to - 90 millivolts).

The neuron cell membrane is super penetrable to potassium ions, thus heaps of potassium spills out of the neuron through potassium spillage channels (openings in the cell divider).

The neuron cell membrane is in part penetrable to sodium ions, so sodium iotas gradually spill into the neuron through sodium spillage channels.

The cell needs to keep up a negative resting membrane potential, so it has a pump that pumps potassium once more into the cell and pumps sodium out of the cell in the meantime.

Answer - sodium enters the neuron followed by potassium leaving the neuron

Hayet Jeridi answered 10 months ago

Next > < Previous

Related Solutions

Which of the following events occurs during transcription?

Part A Which of the following events occurs during transcription? Those segments of the RNA strand that do not actually code for the protein are removed. A molecule of RNA is formed based on the sequence of nucleotides in DNA. The message in mRNA is translated into a protein. A cap is added to the RNA molecule. mRNA binds to a ribosome in the cytoplasm. Part B Which of the following is a correct statement about mRNA? mRNA binds...

describe the correct sequence of events that occurs when the government of a nation that was...

describe the correct sequence of events that occurs when the government of a nation that was originally in equilibrium raises its personal income tax rates. Be sure to mention which curve (AD or SRAS) shifts, which way that curve shifts and the impact that it would have on the nation's price level and Real GDP.

Which of the following is the correct sequence that describes the excitation and contraction of a...

Which of the following is the correct sequence that describes the excitation and contraction of a skeletal muscle fiber? 1. Tropomyosin shifts and unblocks the cross-bridge binding sites. 2. Calcium is released and binds to the troponin complex. 3. The sarcoplasmic reticulum is depolarized when a wave of depolarization moves from the neuromuscular junction into the cell's interior by way of the transverse tubules. 4. The thin filaments are ratcheted across the thick filaments by the heads of the myosin...

13. Describe the basic sequence of events that occurs as an action potential arrives at the...

13. Describe the basic sequence of events that occurs as an action potential arrives at the neuromuscular junction and is transmitted to the muscle cell and leads to a contraction. Explain at the end how relaxation of the muscle takes place (include what happens at the neuromuscular junction and in the muscle fiber. You may use some words multiple times. Fill in the blanks with a complete word or words (no abbreviations) of each step. 1. An action potential arrives...

You are the SELLER in a negotiation. Which of the following patterns correctly describes the relationship...

You are the SELLER in a negotiation. Which of the following patterns correctly describes the relationship between the following values: A. Target<BATNA<Reservation Price B. Target=Reservation Price > BATNA C. BATNA<Reservation Price<Target D. BATNA<Target<Reservation Price E. Reservation Price<Target<BATNA

Which sequence of events most accurately describes the reactive hyperemia response Select one: a. Flow occlusion,...

Which sequence of events most accurately describes the reactive hyperemia response Select one: a. Flow occlusion, increased accumulation of metabolites, arteriolar dilation b. Decreased mean arterial pressure, increased accumulation of metabolites, arteriolar dilation c. Increased mean arterial pressure, decreased accumulation of metabolites, arteriolar constriction d. Increased mean arterial pressure, increased accumulation of metabolites, arteriolar dilation e. Increased mean arterial pressure, increased accumulation of metabolites, arteriolar dilation

Which of the following events occurs in the animal virus life cycle, but NOT in the...

Which of the following events occurs in the animal virus life cycle, but NOT in the bacteriophage life cycle? Check all that apply. Formation of a pro-virus Release by budding Uncoating Use of host cell ribosomes to synthesize viral proteins Biosynthesis Assembly of new virus particles Viral capsid enters into the host cell Lysis

1) Write in order the sequence of events that occurs during muscle contraction. Begin in the...

1) Write in order the sequence of events that occurs during muscle contraction. Begin in the brain and include all action in the muscle. You can write it out like a flow chart, one action followed by the next. 2.The function of the T tubules is to _________. A) Store Ca2+ inside the muscle fiber. B) Rapidly conduct action potentials to the interior of the muscle fiber. C) To store neurotransmitter D) Conduct ATP molecules out of the mitochondria throughout...

. Describe the V(D)J recombination process in terms of the sequence of events that occurs and...

. Describe the V(D)J recombination process in terms of the sequence of events that occurs and the enzymes involved at each step (4 points). Describe why V(D)J recombination is crucial for adaptive immunity

1. Please explain how the sequence of events that occurs when a codon that specifies an...

1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site. 2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence: 3’–ACTACACGACAGGCATAATT—5’ (DNA Template) a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)...

Subjects