. Describe the V(D)J recombination process in terms of the sequence of events that occurs and...

. Describe the V(D)J recombination process in terms of the sequence of events that occurs and the enzymes involved at each step (4 points). Describe why V(D)J recombination is crucial for adaptive immunity

Expert Solution

gladiator answered 1 year ago

Can someone summarize the V(D)J recombination, class switch recombination (CSR) and somatic hypermutation (SHM) with the...

Can someone summarize the V(D)J recombination, class switch recombination (CSR) and somatic hypermutation (SHM) with the mechanism in relationship to antigen and antibody.

Describe the role of V(D)J recombination in anti- body diversification. Explain why nonhomologous end joining is...

Describe the role of V(D)J recombination in anti- body diversification. Explain why nonhomologous end joining is an advantageous mechanism to repair the double-stranded DNA breaks (fusion of the coding segments after the hairpins are hydrolyzed) in the V(D)J recombination pathway.

Explain the following and answer both parts What is the role of Artemis in V(D)J recombination...

Explain the following and answer both parts What is the role of Artemis in V(D)J recombination and why is it important?

describe the correct sequence of events that occurs when the government of a nation that was...

describe the correct sequence of events that occurs when the government of a nation that was originally in equilibrium raises its personal income tax rates. Be sure to mention which curve (AD or SRAS) shifts, which way that curve shifts and the impact that it would have on the nation's price level and Real GDP.

13. Describe the basic sequence of events that occurs as an action potential arrives at the...

13. Describe the basic sequence of events that occurs as an action potential arrives at the neuromuscular junction and is transmitted to the muscle cell and leads to a contraction. Explain at the end how relaxation of the muscle takes place (include what happens at the neuromuscular junction and in the muscle fiber. You may use some words multiple times. Fill in the blanks with a complete word or words (no abbreviations) of each step. 1. An action potential arrives...

Describe the V(D)J and VJ arrangements that occur to generate the variable region of the heavy...

Describe the V(D)J and VJ arrangements that occur to generate the variable region of the heavy and light chains of an antibody. Be sure to list the arrangements in the order in which they occur for each chain. Be sure to include discussion of the following: RAG-1/RAG-2, RSS, Ku, Artemis, DNA Dependent protein kinase, DNA ligase/XRCC4, and terminal deoxynucleotidyl transferase (TdT) and the signal joint. Please help, i don’t understand that at all:(

Somatic Recombination: A) Is a dynamic process of large-scale genomic relocation that occurs in many somatic...

Somatic Recombination: A) Is a dynamic process of large-scale genomic relocation that occurs in many somatic cells. B) Is a dynamic process which generates a large variety of antibodies. C) In the immune system involves three different loci in humans. D) All of these answers are true.

1) Write in order the sequence of events that occurs during muscle contraction. Begin in the...

1) Write in order the sequence of events that occurs during muscle contraction. Begin in the brain and include all action in the muscle. You can write it out like a flow chart, one action followed by the next. 2.The function of the T tubules is to _________. A) Store Ca2+ inside the muscle fiber. B) Rapidly conduct action potentials to the interior of the muscle fiber. C) To store neurotransmitter D) Conduct ATP molecules out of the mitochondria throughout...

1. Please explain how the sequence of events that occurs when a codon that specifies an...

1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site. 2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence: 3’–ACTACACGACAGGCATAATT—5’ (DNA Template) a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)...

Which of the following correctly describes the sequence of events that occurs once a neuron’s threshold...

Which of the following correctly describes the sequence of events that occurs once a neuron’s threshold for forming an action potential is reached? A. Sodium enters the neuron, followed by potassium leaving the neuron. B. Sodium enters the neuron at the same time that potassium leaves the neuron. C. Potassium enters the neuron, followed by sodium leaving the neuron. D. Potassium enters the neuron at the same time that sodium leaves the neuron Please explain the answer in 200 words...

Question