Question

In: Economics

describe the correct sequence of events that occurs when the government of a nation that was...

describe the correct sequence of events that occurs when the government of a nation that was originally in equilibrium raises its personal income tax rates. Be sure to mention which curve (AD or SRAS) shifts, which way that curve shifts and the impact that it would have on the nation's price level and Real GDP.

Solutions

Expert Solution

Ans. When government increases personal income tax, households' disposable income falls. So, there consumption falls leading to fall in aggregate demand for goods and services shifting the aggregate demand curve rightwards from AD to AD". So, this leads to decrease in transaction demand for money leading to a fall in interest rate. This fall in interest rate partially offsets the decrease in aggregate demand for goods and services because a fall in interest rate decreases cost of borrowing inducing investment spending. This shifts the aggregate demand curve rightwards from AD" to AD'. But the net effect still is decrease in aggregate demand, so, at given aggregate supply it leads to a surplus of goods and services in the market decreasing tge price level from P to P' which reduces quantity supplied moving the equilibrium output to a decreased level Y' from Y.

* Please don’t forget to hit the thumbs up button, if you find the answer helpful.


Related Solutions

13. Describe the basic sequence of events that occurs as an action potential arrives at the...
13. Describe the basic sequence of events that occurs as an action potential arrives at the neuromuscular junction and is transmitted to the muscle cell and leads to a contraction. Explain at the end how relaxation of the muscle takes place (include what happens at the neuromuscular junction and in the muscle fiber. You may use some words multiple times. Fill in the blanks with a complete word or words (no abbreviations) of each step. 1. An action potential arrives...
1. Please explain how the sequence of events that occurs when a codon that specifies an...
1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site. 2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence: 3’–ACTACACGACAGGCATAATT—5’ (DNA Template) a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)...
. Describe the V(D)J recombination process in terms of the sequence of events that occurs and...
. Describe the V(D)J recombination process in terms of the sequence of events that occurs and the enzymes involved at each step (4 points). Describe why V(D)J recombination is crucial for adaptive immunity
Which of the following is the correct sequence of events when a free and competitive market is in a surplus situation?
  Which of the following is the correct sequence of events when a free and competitive market is in a surplus situation? (a) The market price will increase, which will lead to an increase in Qs and a decrease in Qd until the market reaches another equilibrium position where Qs=Qd. (b) The market price will increase, which will lead to a decrease in Qs and an increase in Qd until the market reaches another equilibrium position where Qs=Qd. (c) The...
Number the events below 1 – 7 to represent the correct sequence of events in skeletal...
Number the events below 1 – 7 to represent the correct sequence of events in skeletal muscle contraction and relaxation ___Ca2+ binds to troponin; tropomyosin moves, exposing the active site of actin ___Acetylcholine (ACh) triggers an end-plate potential in the motor end plate. ___ The motor neuron stops releasing ACh and Acetylcholinesterase degrades the ACh in the synaptic cleft ___An Action potential in the sarcolemma travels down the T-Tubules ___ Ca2+ is released from the sarcoplasmic reticulum into the cytosol...
Describe the series of events that occurs when a ligand binds to a receptor tyrosine kinase...
Describe the series of events that occurs when a ligand binds to a receptor tyrosine kinase during cellular signalling, and what occurs once the ligand is removed? Describe the series of events that occurs before and after a ligand binds to a G protein coupled receptor during cellular signalling?
1) Write in order the sequence of events that occurs during muscle contraction. Begin in the...
1) Write in order the sequence of events that occurs during muscle contraction. Begin in the brain and include all action in the muscle. You can write it out like a flow chart, one action followed by the next. 2.The function of the T tubules is to _________. A) Store Ca2+ inside the muscle fiber. B) Rapidly conduct action potentials to the interior of the muscle fiber. C) To store neurotransmitter D) Conduct ATP molecules out of the mitochondria throughout...
Which of the following correctly describes the sequence of events that occurs once a neuron’s threshold...
Which of the following correctly describes the sequence of events that occurs once a neuron’s threshold for forming an action potential is reached? A. Sodium enters the neuron, followed by potassium leaving the neuron. B. Sodium enters the neuron at the same time that potassium leaves the neuron. C. Potassium enters the neuron, followed by sodium leaving the neuron. D. Potassium enters the neuron at the same time that sodium leaves the neuron Please explain the answer in 200 words...
List and describe the sequence of events for injection molding.
List and describe the sequence of events for injection molding.
Decide which sequence of events is most CORRECT for the initiation and elongation steps of translation...
Decide which sequence of events is most CORRECT for the initiation and elongation steps of translation in prokaryotic cells? (1) small ribosomal subunit binds to mRNA (2) initiator tRNA binds start codon on mRNA (3) active 70S ribosome is formed (4) translocation of ribosome (5) binding of second aminoacyl tRNA A. 2, 3, 1, 5, 4 B. 1, 2, 3, 5, 4 C. 2, 1, 3, 4, 5 D. 1, 2, 3, 4, 5 E. 1, 3, 2, 4, 5
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT