Question

In: Anatomy and Physiology

1) Write in order the sequence of events that occurs during muscle contraction. Begin in the...

1) Write in order the sequence of events that occurs during muscle contraction. Begin in the brain and include all action in the muscle. You can write it out like a flow chart, one action followed by the next.

2.The function of the T tubules is to _________.

A) Store Ca2+ inside the muscle fiber.

B) Rapidly conduct action potentials to the interior of the muscle fiber.

C) To store neurotransmitter

D) Conduct ATP molecules out of the mitochondria throughout the sarcoplasm.

E) All of the above are functions of the T tubules

Solutions

Expert Solution

The sequence of events that occurs during muscle contraction

2. The function of the T tubules is to

  • A) Store Ca2+ inside the muscle fiber.
  • B) Rapidly conduct action potentials to the interior of the muscle fibre.
  • C) To store neurotransmitter
  • D) Conduct ATP molecules out of the mitochondria throughout the sarcoplasm.
  • E) All of the above are functions of the T tubules

Ans: B) Rapidly conduct action potentials to the interior of the muscle fibre.

The sarcoplasmic reticulum store calcium ions (Ca2+)

Neurotransmitters are stored in synaptic vesicles,

Sarcoplasm Conduct ATP molecules out of the mitochondria throughout the sarcoplasm.


Related Solutions

During the excitation phase of the skeletal muscle cell contraction, the following occurs: 1) the muscle...
During the excitation phase of the skeletal muscle cell contraction, the following occurs: 1) the muscle fiber develops tension and shortens 2) the muscle fiber relaxes and returns to its original length 3) nerve action potentials lead to muscle action potentials A growing long bone in a child has only two types of cartilage at the epiphysis. These two areas are 1) elastic cartilage and epiphyseal plate 2) epiphyseal plate and epiphyseal line 3) primary and secondary ossification centers 4)...
what is the sequence of events of skeletal muscle contraction, including stimulation by the nervous system,...
what is the sequence of events of skeletal muscle contraction, including stimulation by the nervous system, structure and role of myofilaments and calcium including where it is stored in the muscle and what causes its release. what role does energy play in muscle comtraction?
Describe the sequence of events (contraction and fetal heart rate) during a normal contraction. Explain the...
Describe the sequence of events (contraction and fetal heart rate) during a normal contraction. Explain the term variable deceleration and late deceleration and if any nursing interventions are necessary.
Which of the following occurs during a muscle contraction ? The distance between the z-discs lengthens...
Which of the following occurs during a muscle contraction ? The distance between the z-discs lengthens The A band shortens The I band and the A band switch positions thick and thin myofillaments shorten The sarcomeres shorten Jogging, swimming, and aerobics all have this effect on skeletal muscle tissue. Decreased # of myofillaments Increased # of nuclei per muscle cell Increased # of motor units None of the above Increased # of muscle fibers In the sliding filament model, ________...
Angular work is positive during eccentric muscle contraction and negative during concentric muscle contraction. With the...
Angular work is positive during eccentric muscle contraction and negative during concentric muscle contraction. With the aid of sketches, explain the reason for work to be positive and negative for eccentric and concentric muscle actions, respectively.
PUT THE EVENTS OF MUSCLE CONTRACTION IN ORDER Question 28 options: 12345 Calcium ions attach to...
PUT THE EVENTS OF MUSCLE CONTRACTION IN ORDER Question 28 options: 12345 Calcium ions attach to the troponin. This causes the tropomyosin to move away from the actin active sites. 12345 An ATP molecule provides the energy to return the myosin cross bridge back to its original (cocked) position 12345 Myosin heads bend and pull the actin over the myosin 12345 Myosin cross bridges attach to the active sites of the actin 12345 Nerve stimulation causes Calcium ions to be...
1. Please explain how the sequence of events that occurs when a codon that specifies an...
1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site. 2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence: 3’–ACTACACGACAGGCATAATT—5’ (DNA Template) a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)...
Is the following the correct order of steps leading to muscle contraction? (Yes or No) If...
Is the following the correct order of steps leading to muscle contraction? (Yes or No) If you think the order is incorrect, then what would be the correct order? a. secretion of acetylcholine by the motor neuron b. attachment of acetylcholine to receptors on the motor end plate of the sarcolemma c. opening of sodium channels in the sarcolemma d. depolarization of the sarcolemma e. action potential reaching the sarcoplasmic reticulum f.   release of calcium ions by the sarcoplasmic reticulum...
describe the correct sequence of events that occurs when the government of a nation that was...
describe the correct sequence of events that occurs when the government of a nation that was originally in equilibrium raises its personal income tax rates. Be sure to mention which curve (AD or SRAS) shifts, which way that curve shifts and the impact that it would have on the nation's price level and Real GDP.
1. Explain why the A band does not change length during muscle contraction but the I...
1. Explain why the A band does not change length during muscle contraction but the I band and H-zone do change length. 2. Describe the cause of muscle strength gains early (1st 8 weeks) in a resistance training program and the cause of muscle strength gains later (after 8 weeks) in a resistance training program. 3. Explain what myonuclear domain is and what myonuclear domain threshold is. 4. Explain why it is important for myosin heads within a myosin protein...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT