Question

In: Biology

1. Please briefly explain the following. a.) Discuss the sequence of events in the B-cell response...

1. Please briefly explain the following. a.) Discuss the sequence of events in the B-cell response to a thymus-dependent antigen. b.) Discuss the structure and function of class I and II MHC molecules. c.) Discuss the development of T cells in the thymus.

Solutions

Expert Solution

Answer (a)

  • Activation of B cells by soluble antigen or thymus dependent antigen requires the involvement of T helper cells.
  • Activation of B cells require binding of antigen to B cell membrane bound immunoglobulin receptors (mIgs).
  • Antigen crosslinks mIg, generating signal1 which leads to increased expression of class II MHC and costimulatory B7.
  • Antigen, internalized by receptor mediated endocytosis and degraded to peptides.
  • Processed peptides are bound by class II MHC on B cells membrane.
  • This interaction activates T helper cell.
  • Interaction of CD40 (present on B cell membrane) and CD 40 L (present on T helper cells) provides signal 2 for B cell activation.
  • Interaction between B7 of B cell membrane and CD28 present on T helper cell membrane provide co-stimulation to the T helper cell.
  • In the presence of signal, B cell begins to express receptors for cytokines (IL-2, IL-4 ,IL-5 etc).
  • Binding of cytokines (Released by T helper cell) to the cytokine receptor of B cells promotes differentiation of B cells.

Answer (b)

MHC molecules

Structure of MHC molecules

  • Class I MHC has -chain and 2 microglobulin and class II is a hetrodimer of and chain.
  • 1 and 2 domains of chain forms the polymorphic region of class I MHC molecule and 1 and 1 forms the polymorphic region of class II MHC molecules.
  • 3 region of class I forms the binding site for T cell Co-receptor of CD8 cells and
  • 2 region of Class II forms the binding sites for T cell co-receptor of CD4 cells.
  • Both types of membrane glycoproteins (class I and class II MHC) function as highly specialized antigen-presenting molecules.

Function

  • The class I and class II MHC molecules present antigen to T cells.
  • Antigen recognition is mediated by or T cell antigen receptors (TCR).
  • T cells recognize only peptides combined with MHC molecules.
  • Class I molecules present processed endogenous antigen to CD8 T cells.
  • Class II molecules present processed exogenous antigen to CD4 cells.
  • Class I MHC molecules presents peptide of 8-10 amino acids.
  • Class II molecules molecules bind and present longer peptide of 13-18 aminoacids.

Answer (c)

  • Development or maturation of T cells occurs in the thymus.
  • The progenitor T cells (Pro-T cells) migrate from the bone marrow into the thymus under the influence of chemotactic factors that are secreted by the thymic epithelial cells.
  • In the thymus, developing T cells, known as thymocytes, proliferate and differentiate.
  • Pro-T cell lacks the CD4 and CD8 co-receptors.


Related Solutions

1. Please explain how the sequence of events that occurs when a codon that specifies an...
1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site. 2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence: 3’–ACTACACGACAGGCATAATT—5’ (DNA Template) a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)...
Please explain how the sequence of events that occurs when a codon that specifies an amino...
Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site.
please explain the following: a) briefly explain elasticity of demand and how it is measured b)...
please explain the following: a) briefly explain elasticity of demand and how it is measured b) Explain with diagrams and relevant examples, THREE (3) categories of price elasticity of demand. c) Explain any THREE (3) of price elasticity of demand.. please provide references
Mitosis unfolds through a sequence of stages marked by specific events in the cell.
Mitosis unfolds through a sequence of stages marked by specific events in the cell. The structural changes in the cell are about by a series of tightly coordinated underlying mechanisms. Sort each process into the appropriate bin to indicate the stage of mitosis in which it occurs. If a process occurs in more than one stage, sort it to the stage when it first occurs. Cohesins join sister chromatids of duplicated chromosome. Tubulins assemble into spindle microtubules. Microtubules attach to...
Type a complete response to each of the following questions. 1. Identify and briefly explain the...
Type a complete response to each of the following questions. 1. Identify and briefly explain the four levels of intercultural communication competence. Find or create an example of each level. 2. How are intercultural relationships portrayed in our media and pop culture? Try to find a specific example that demonstrates an intercultural couple and explain their portrayal. For example, are they positively portrayed? Negatively? How? How do they interact with other couples in their environment?
Briefly discuss the following: 1. Events that changed the world in microbiology. (20 marks) 2. Microbiology...
Briefly discuss the following: 1. Events that changed the world in microbiology. 2. Microbiology came about looking for the mystery of life. Do you agree? Why?
1 Please briefly discuss: a. methods of dealing with the allocation problem. b. the general rules...
1 Please briefly discuss: a. methods of dealing with the allocation problem. b. the general rules related to revenue recognition. c. the general rules for allocating tax expenses between periods.
1 Please briefly discuss: a. methods of dealing with the allocation problem. b. the general rules...
1 Please briefly discuss: a. methods of dealing with the allocation problem. b. the general rules related to revenue recognition. c. the general rules for allocating tax expenses between periods.
Briefly explain why organized labor was opposed to NAFTA. Please type response, thanks
Briefly explain why organized labor was opposed to NAFTA. Please type response, thanks
Number the events below 1 – 7 to represent the correct sequence of events in skeletal...
Number the events below 1 – 7 to represent the correct sequence of events in skeletal muscle contraction and relaxation ___Ca2+ binds to troponin; tropomyosin moves, exposing the active site of actin ___Acetylcholine (ACh) triggers an end-plate potential in the motor end plate. ___ The motor neuron stops releasing ACh and Acetylcholinesterase degrades the ACh in the synaptic cleft ___An Action potential in the sarcolemma travels down the T-Tubules ___ Ca2+ is released from the sarcoplasmic reticulum into the cytosol...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT