A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced....

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below.

Fragment 1: 5'-TAGTTAAAAC-3'

Fragment 2: 5' - ACCGCAATACCCTAGTTAAA-3'

Fragment 3: 5' - CCCTAGTTAAAAC-3'

Fragment 4: 5' - ACCGCAATACCCTAGTT - 3'

Fragment 5: 5' - ACCGCAATACCCTAGTTAAA - 3'

Fragment 6: 5' - ATTTACCGCAAT - 3'

On the basis of overlap in sequence, create a contig sequence of the original piece of DNA

Expert Solution

Contig sequence: Continuous sequence of DNA made from the reassembly of the small DNA fragments. In bottom-up DNA sequencing method genomic DNA is fragmented into several pieces & then sequencing of these fragments are done. Then these fragments are reassembled into contigs.

To find the original DNA sequence we have to find the fragments that are overlapped with each other & then continue this process until we are done with all the fragments.

We find that fragment 1 is completely overlapped with fragment 5. Overlapping these two sequences we find-

Now we find that new sequence is overlapped with Fragment 2 or 5 (Also we find that fragment 2 & 5 are same).

Now fragment 4 is completely overlapped with this new sequence.

Now overlapping fragment 6 with the new sequence we find the final sequence.

gladiator answered 2 years ago

matching fragment DNA at specific sites hybridize DNA fragments with labeled probe create DNA features on...

matching fragment DNA at specific sites hybridize DNA fragments with labeled probe create DNA features on a DNA microchip prepare mRNA for DNA sequencing transform eukaryotic cells with electricity detect the amount of or the 5’ end of mRNA visualize DNA, RNA or other small structures a type of electrophoresis detect protein binding to DNA use antibody to detect a specific protein use antibody to purify a specific protein amplify a specific locus of DNA adding transformed ES to blastocyst...

In a linear fragment of DNA, the ends can not be replicated by DNA polymerases.

What are the SD sequences? Found in the promoters of RNA polymerase I Found in the promoters of RNA polymerase II Found in the promoters of RNA polymerase III Ribosome binding sites in prokaryotic mRNA Ribosome binding sites in eukaryotic mRNA In a linear fragment of DNA, the ends can not be replicated by DNA polymerases. Eukaryotes use telomerase enzyme to replicate chromosome tips. This enzyme has DNA polymerase activity RNA polymerase activity Reverse transcriptase activity DNA ligase...

4. In your studies with mice, you have sequenced a piece of wild-type DNA and it...

4. In your studies with mice, you have sequenced a piece of wild-type DNA and it clearly contains a gene, but you do not know what this gene does. Therefore, to investigate further, you would like to create a transgenic mouse to learn more about the phenotypic qualities this gene confers. What kind of transgenic mouse would allow you to correctly determine any phenotypes that depend on this gene’s function? How would you go about making such a mouse?

You digest a random piece of linear DNA of 2222 bp long with MluCl (5’ AATT3’)....

You digest a random piece of linear DNA of 2222 bp long with MluCl (5’ AATT3’). a. Approximately how many cuts and how fragments (whole number) would we expect to get? (2 pt) b. If the random piece of DNA from a) was subsequently found to have a G/C ratio of 65% would you expect the number of fragments to increase or decrease and why? (1 pt) c. If the random piece of DNA was actually circular plasmid DNA, how...

For each fragment of DNA provided: circle the promoter region transcribe the DNA into mRNA indicate...

For each fragment of DNA provided: circle the promoter region transcribe the DNA into mRNA indicate the directionality on both the DNA fragment and mRNA underline the mRNA start codon (if applicable) circle the mRNA stop codon (if applicable) build the polypeptide (if applicable) use the short form of the amino acids. illustrate and label the bond type that holds the polypeptide together provide an ordered list of the tRNA anticodons that were required to build the polypeptide #1: GCCCTCGGCAAATTAATAGATCTGTACAACGCCTCGCAAATAACTGCG...

-Describe the process of gel electrophoresis. How would the distance that each DNA fragment travelled on...

-Describe the process of gel electrophoresis. How would the distance that each DNA fragment travelled on your gel change if you were to make the gel using a higher percentage of agarose (for example 3%)? Explain -Describe the steps involved in a polymerase chain reaction (PCR), including the changes in temperature that are performed by the thermocycler and the purpose of each temperature change.

2) A random sample of 10 miniature Tootsie Rolls was taken from a bag. Each piece...

2) A random sample of 10 miniature Tootsie Rolls was taken from a bag. Each piece was weighed on a very accurate scale. The results in grams were: 3.087 3.131 3.241 3.241 3.270 3.353 3.400 3.411 3.437 3.477 -Assuming a normal population, use Minitab to construct a 95 percent confidence interval for the true mean weight. You will need to enter the data. Attach or include your output. (4 points) -Write a sentence using the confidence interval found in part...

Question