In: Biology
A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below.
Fragment 1: 5'-TAGTTAAAAC-3'
Fragment 2: 5' - ACCGCAATACCCTAGTTAAA-3'
Fragment 3: 5' - CCCTAGTTAAAAC-3'
Fragment 4: 5' - ACCGCAATACCCTAGTT - 3'
Fragment 5: 5' - ACCGCAATACCCTAGTTAAA - 3'
Fragment 6: 5' - ATTTACCGCAAT - 3'
On the basis of overlap in sequence, create a contig sequence of the original piece of DNA
Contig sequence: Continuous sequence of DNA made from the reassembly of the small DNA fragments. In bottom-up DNA sequencing method genomic DNA is fragmented into several pieces & then sequencing of these fragments are done. Then these fragments are reassembled into contigs.
To find the original DNA sequence we have to find the fragments that are overlapped with each other & then continue this process until we are done with all the fragments.
We find that fragment 1 is completely overlapped with fragment 5. Overlapping these two sequences we find-

Now we find that new sequence is overlapped with Fragment 2 or 5 (Also we find that fragment 2 & 5 are same).

Now fragment 4 is completely overlapped with this new sequence.

Now overlapping fragment 6 with the new sequence we find the final sequence.
