Question

write a self assessment assay grading yourself out 10 on experimental report you just have presented . I need an example please. Just in 200 words. I will make for myself after reading your writting as an example.

Answer 1

According to me, an experimental report should not be elaborate, but rather should be detailed, crisp, precise and to the point. In an attempt to grade oneself out of 10, I would prefer, if the following aspects (in bold) are checked in the report, each accounting for points indicated in brackets.

1) Objective (1) : Should be short, clear and to the point, such that it grasps the attention of the reader, in not more than 10-12 words.  

eg: "Transcription factor GAL4 binds to a GC-rich DNA sequence." rather than "Galactose responsive transcription factor GAL4 binds to CGCGTTA sequence on the given DNA template"

2) Background or Literature Review (2): What is the basis of the experiment, how and why it should be done, what is the expected outcome?

eg: Transcription factors bind to DNA at precise locations or sites on the DNA sequence. Galactose responsive transritption factor or GAL4 , found in yeast, positively regulates expression of galactose induced genes. Upon binding to DNA in sufficient quantities, GAL4 TF can obstruct binding of DNAseI enzyme, which cleaves DNA at locations sensititve to the latter enzyme. This fact is taken advantage of in a DNA footprinting experiment, where the DNA is radiolabelled with 32P at one of its end and exposed to sufficient amounts of GAL4, before DNAseI treatment. After limited digestion with DNAseI, the reaction is quenched, DNA is precipitated and analysed on a polyacrylamide gel. The GAL4TF will protect the DNA from the DNaseI enzyme and will not allow any cleavage of DNA in the protected region. Therefore in the gel those protected fragments will not light up in GAL4 treated DNA template, in contrast to the control lane where GAL4 was not added. Rather in the control lane, a ribbon pattern following DNaseI treatment will be noticeable, with an array of labelled fragments. If the sequence of the DNA is available with the autoradiogram pattern following Sangers methodology, the GAL4 binding site can be easily determined.

3) Experimental Procedures (2): Mentioning the detailed description of the experiment done. Control and experimental samples and replicates need mention.

Materials required for a footprinting reaction, making apropiate protein and DNA dilutions in proper binding buffer, Preparation and addition of salt for proper binding, firstly allow binding of DNA radiolabelled template and GAL4 binding under appropiate buffer and reaction conditions at particular temperature, pH and salt conditions. One tube should be control without GAL4 and trhe other tube should be experiment with GAL4. Following this perform the footprinting reaction with proper dilution of DNase I and stop the reaction. Centrifuge and precipitate the DNA, electrophorese in the polyacrylamide gel. Dry the gel and cover withSaran or thin transparent film to be exposed to phosphorimager cassette. The pattern of DNaseI cleavage in control and experimental lanes appear in the phosphorimager scan.

4) Observations (2): Number out the observations seen after performing the experiment.

As seen in the autoradiogram of the dried gel, a number of radiolabelled bands are missing in the experimental sample treated with GAL4, in contrast to the control sample, where no GAL4 was added. As can be seen from the pattern of Sanger sequencing for the given DNA template (suppose ' 5'- GGATTCTAATAAAGTAACGCGTTACGACTTGG -3') , missing bands correspond to the underlined sequence given, which indicates the GAL-4 binding site for the given DNA template.

5) Conclusion (2): What is the main inference drawn from the experiment? Are the results conclusive? If not, what all things should be taken care of?.

GAL4 binds to the DNA sequence 5' GGATTCTAATAAAGTAACGCGTTACGACTTGG -3' at a precise GC rich motif CGCGTTA, as can be seen from the missing bands in the lane corresponding to the experimental sample where the DNA has been treated with GAL4. However it is important to verify whether GAL4 has a preference for GC rich sequences by repeatin g the experiments with DNA templates containing GC rich motifs, or with structure particular to this DNA molecule.

6) Precautions (1): All the precautions that should be practised during an experiment, so as to avoid any false conclusions/mishaps/spoilage of resources.

Precautions should be taken while handling radioactive items and materials to avoild spillage and spoilage, Exposure to radiolabelled samples should be restricted by use of shields, aprons and gloves, disposal of such items should be done carefully in separate containers. The DNA-GAL4 binding reaction should be carefully done under appropiate temperature and buffer conditions while the DNAse I footprinting reaction should be stopped at precise timings.

7) Future directions (1): What other experiments can be proposed? What other information can be derived from such experiments?.

From the above experiment, it is clear that GAL4 TF binds to specific GC rich motif in the given DNA template. However one should verify if the specificity for GC rich motif also persists for other DNA templates. Additionally a concentration dependence of GAL4 binding should be done to understand the specificity of this TF towards a particular motif. The binding kinetics of DNA-TF can therefore be worked out.

If your experimental report is aboslutely different, there is nothing to worry, but check whether you have written and stressed on the main points given in bold. Then write affirmative sentences, for example: The title of my report is self-explanatory and precise, explaining the reader the motive and the main finding of this experiment.