Question

In: Biology

How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? How...

How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? How and why do consensus sequences differ from one another?

Solutions

Expert Solution

Transcription initiation starts with RNA polymerase binding to DNA of the gene at the region called promoter. The promoter sequence in the DNA signals the polymerase to bind at that particular sequence and start transcribing. Each gene has its own promoter where RNA polymerase binds, transcription bubble forms and trancription is initiated. The promoter sequence in eukaryotes have a consensus sequence called TATA box. This sequence will allow the RNA polymerase and other transcription factors to bind for initiation of transcription.

Transcription termination happens when a stop signal is seen on the DNA. It happens once the polymerase transcribes a sequence of DNA known as a terminator. In Rho dependent termination, the RNA contains a binding for a protein called Rho factor. Rho factor binds to this sequence and starts climbing up the transcript towards RNA polymerase. Rho pulls the RNA transcript and the template DNA strand apart releasing the RNA molecule and ending transcription. Rho independent termination depends on specific sequences in the DNA template strand. As the RNA polymerase approached the end of the gene being transcribed, it hits a region rich in G and C nucleotides. The RNA transcribed from this region folds back on itself. The hairpin that causes polymerase to stall.

A typical promoter contains two important DNA sequences, the -10 and -35 elements. RNA polymerase recognizes the polymerase in the right spot to start transcibing a target gene.

Many eukaryotic promoters have a sequence called a TATA box which plays a role much like that of the -10 element in bacteria.


Related Solutions

The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin?
The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin? Select all that are correct.A. Ribosomal subunitsB. A start codonC. DNA polymerase enzymeD. General transcription factorsE. RNA polymerase enzyme
The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start...
The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start site) is indicated as the red/bold “g”. cggctcaataaaataacaggagtctataaaagcgtggggacagttcaggagggggctcgc TBP binds a cis-acting element within this sequence. What is the coordinate of the 5’ deoxynucleotide of this cis-acting element?
what are the roles of transcription factors and the promoter reguon in transcription?
what are the roles of transcription factors and the promoter reguon in transcription?
Briefly explain how a transcription factor located 10,000 nucleotides upstream of the promoter sequence can influence...
Briefly explain how a transcription factor located 10,000 nucleotides upstream of the promoter sequence can influence gene expression.
Describe what is meant by the term consensus sequences for transcription in E. coli and their...
Describe what is meant by the term consensus sequences for transcription in E. coli and their significance in regulating transcription from promoters recognized by the σ70 factor.
Discuss what you understand by the term 'promoter' in the context of transcription? (500 words)
Discuss what you understand by the term 'promoter' in the context of transcription? (500 words)
Briefly explain what will happen to the transcription of a gene, if its core promoter elements...
Briefly explain what will happen to the transcription of a gene, if its core promoter elements (Class II promoter with 3 elements: BRE, TATA and Inr) are moved downstream to the TSS (transcription site)? Explain why eukaryotic cells have general and specific transcription factors?
summarize the process of RNAP binding to the promoter during transcription.
summarize the process of RNAP binding to the promoter during transcription.
1. What is the importance of the TATA box and transcription factors 2.What is the importance...
1. What is the importance of the TATA box and transcription factors 2.What is the importance of initiation complex 3.why should tRNA be charged with N-formylmethionine or methionine, what would happen if the tRNA was not charged?
A. Draw a typical bacterialgene. Be sure to includeand labelthe promoter, transcription start site, transcription terminator,coding...
A. Draw a typical bacterialgene. Be sure to includeand labelthe promoter, transcription start site, transcription terminator,coding region, and untranslated regions. Below the gene draw a full-length mRNA transcript of the gene. On the mRNA, label the 5’ & 3’ ends, the coding region, and the UTRs. B. Draw a typical eukaryotic gene. Be sure to includeand labelthe core promoter, some proximal promoterelements, one enhancer,transcription start site, two introns, poly(A) addition signal, coding region, and untranslated regions. Below the gene draw...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT