A. Draw a typical bacterialgene. Be sure to includeand labelthe promoter, transcription start site, transcription terminator,coding...

A. Draw a typical bacterialgene. Be sure to includeand labelthe promoter, transcription start site, transcription terminator,coding region, and untranslated regions. Below the gene draw a full-length mRNA transcript of the gene. On the mRNA, label the 5’ & 3’ ends, the coding region, and the UTRs.

B. Draw a typical eukaryotic gene. Be sure to includeand labelthe core promoter, some proximal promoterelements, one enhancer,transcription start site, two introns, poly(A) addition signal, coding region, and untranslated regions. Below the gene draw a full-length primary transcript of the gene with the 5’ and 3’ ends labeled, and below that draw the final mature mRNAwith the ends and coding sequence labeled. Be sure it is clear which parts of the gene are represented in the primary transcript and the mRNA.

C. Onthe two gene drawings above, indicate which trans-acting factors (=proteins) bind to the cis-acting elements (=DNA sequences) that you included in your drawing. Where appropriate, it is sufficient to give the name of a type of protein rather than a specific protein.

Expert Solution

gladiator answered 2 years ago

Draw a typical eukaryotic gene. Be sure to include and label the core promoter, some proximal...

Draw a typical eukaryotic gene. Be sure to include and label the core promoter, some proximal promoter elements, one enhancer,transcription start site, two introns, poly(A) addition signal, coding region, and untranslated regions. Below the gene draw a full-length primary transcript of the gene with the 5’ and 3’ ends labeled, and below that draw the final mature mRNA with the ends and coding sequence labeled. Be sure it is clear which parts of the gene are represented in the primary...

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start...

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start site) is indicated as the red/bold “g”. cggctcaataaaataacaggagtctataaaagcgtggggacagttcaggagggggctcgc TBP binds a cis-acting element within this sequence. What is the coordinate of the 5’ deoxynucleotide of this cis-acting element?

The map of the lac operon is: POZY The promoter (P) region is the start site of...

The map of the lac operon is: POZY The promoter (P) region is the start site of transcription through the binding of RNA polymerase before actual mRNA production. Mutationally altered promoters (P-) cannot bind RNA polymerase. Certain predictions can be made about the effect of P- mutations. Use your predictions and your knowledge of the lactose system to complete the following table. Insert a “+” where an enzyme is produced and a “-“ where no enzyme is produced. The first one...

A(n) _____ is located upstream of a gene's coding region. a. promoter b. start codon c....

A(n) _____ is located upstream of a gene's coding region. a. promoter b. start codon c. origin of replication d. 3' UTR e. stop codon Transcription results in the production of (select all that apply): a. rRNA b. RNA polymerase c. tRNA d. mRNA e. polypeptides f. enzymes g. DNA h. Okazaki fragments

what are the roles of transcription factors and the promoter reguon in transcription?

Eukaryotic transcription factors often bind to DNA at sites long distances from the transcription start site....

Eukaryotic transcription factors often bind to DNA at sites long distances from the transcription start site. These DNA regions are called:

The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin?

The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin? Select all that are correct.A. Ribosomal subunitsB. A start codonC. DNA polymerase enzymeD. General transcription factorsE. RNA polymerase enzyme

True/False: There are usually less mutations near the transcription start site of the variable region for...

True/False: There are usually less mutations near the transcription start site of the variable region for an antibody. Which of the following is most analogous (or most closely matches) to the germinal center in the secondary lymphoid tissue? a. the cortex of the thymus b. the spongy tissue of the bone c. the medulla of the thymus d. the plasma of the bone marrow Which of the following is not part of the T-cell receptor complex? a. alpha chain b....

summarize the process of RNAP binding to the promoter during transcription.

a promoter ___ a cis acting site 1. is 2. is not

Question