Question
In: Biology
The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start...
The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start site) is indicated as the red/bold “g”.
cggctcaataaaataacaggagtctataaaagcgtggggacagttcaggagggggctcgc
TBP binds a cis-acting element within this sequence. What is the coordinate of the 5’ deoxynucleotide of this cis-acting element?
Solutions
Expert Solution
TBP = TATA binding protein.
It is a general transcription factor that binds to the TATA box +30
base upstream to the transcription start site.
TATA box consencus sequence: 5'-TATA(A/T)A(A/T)-3'
Given sequence:
CGGCTCAATAAAATAACAGGAGTCTATAAAAGCGTGGGGACAGTTCAGGAGGGGGCTCGC
The position of TATA box is bold, italic and underlined.
gladiator answered 2 years agoRelated Solutions
The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin?
The
promoter is an important sequence for transcription of a gene.
Which of these components binds to the promoter of a eukaryotic
gene to allow transcription to begin? Select all that are
correct.A. Ribosomal subunitsB. A start codonC. DNA polymerase enzymeD. General transcription factorsE. RNA polymerase enzyme
A) The +1 start of transcription is at position 52 of the following sequence. If the...
A) The +1 start of transcription is at position 52 of the
following sequence. If the top strand is the coding strand, and the
bottom strand is the template strand, write out the transcribed RNA
sequence.
5' TACCGAGAGAGGTTGACAAATGCCTAGATTGATGATTATA 3'
3' ATGGCTCTCTCCAACTGTTTACGGATCTAACTACTAATAT 5'
0000000001111111111122222222233333333334
1234567890123456789012345678901234567890
5' TAATTCGGATGAGAGGGTTCAGGACAAGCTTTAGCCCTAT 3'
3' ATTAAGCCTACTCTCCCAAGTCCTGTTCGAAATCGGGATA 5'
4444444445555555555666666666677777777778
1234567890123456789012345678901234567890
(Write the sequence of nucleotides from the start site to the end without spaces or any other characters, just a string of RNA nucleotides)
Eukaryotic gene regulation: transcription initiation Initiation & the transcription initiation complex (including enhancers). Promoter; TATA box;...
Eukaryotic gene regulation: transcription
initiation
Initiation & the transcription initiation complex (including
enhancers).
Promoter; TATA box; Conserved & variable regions in
promoters.
Eukaryotic enhancers. Why is it important that there are
multiple control elements in a single enhancer? What binds to the
control elements? How is it possible for a small number of
activator and transcription factor proteins to regulate a large
number of genes?
Transcription: Elongation & RNA polymerase. RNA polymerase
vs. DNA polymerase. Termination.
MyoD: What makes it...
How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? How...
How is transcription initiated and terminated? What is the
importance of the promoter consensus sequence? How and why do
consensus sequences differ from one another?
A. Draw a typical bacterialgene. Be sure to includeand labelthe promoter, transcription start site, transcription terminator,coding...
A. Draw a typical bacterialgene. Be sure to includeand labelthe
promoter, transcription start site, transcription terminator,coding
region, and untranslated regions. Below the gene draw a full-length
mRNA transcript of the gene. On the mRNA, label the 5’ & 3’
ends, the coding region, and the UTRs.
B. Draw a typical eukaryotic gene. Be sure to includeand
labelthe core promoter, some proximal promoterelements, one
enhancer,transcription start site, two introns, poly(A) addition
signal, coding region, and untranslated regions. Below the gene
draw...
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...
Part of a gene sequence from a eukaryotic cell is written below.
Transcription begins at the boxed G/C base pair and proceeds from
left to right.
5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’
1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - -
+- - - - - - - - -+ - - - - - - - - - - - -+...
Eukaryotic transcription factors often bind to DNA at sites long distances from the transcription start site....
Eukaryotic transcription factors often bind to DNA at sites long
distances from the transcription start site. These DNA regions are
called:
what are the roles of transcription factors and the promoter reguon in transcription?
what are the roles of transcription factors and the promoter reguon
in transcription?
Briefly explain how a transcription factor located 10,000 nucleotides upstream of the promoter sequence can influence...
Briefly explain how a transcription factor located 10,000
nucleotides upstream of the promoter sequence can influence gene
expression.
What sequence is normally placed between the end of a promoter in the start codon (ATG) to ensure efficient translation?
What sequence is normally placed between the end of a promoter in the start codon (ATG) to ensure efficient translation? include the name of the sequence and an example of it
ADVERTISEMENT
ADVERTISEMENT
Latest Questions
- Need to answer the following 3 questions from "The Sixties, AMerican Yawp" (just google, you will...
- Write a c++ program to load two column of numbers, do arithmetic operations to the data...
- A forklift can be leased for $3000 per month, with maintenance and insurance included. Alternatively, the...
- Assume that I can borrow money at a rate of 10% per year, but that I...
- The newly elected president Susan implements some policies with the intention of boosting income. She succeeds...
- Multiple Production Department Factory Overhead Rates The total factory overhead for Urban Styles, Inc. is budgeted...
- using this code under, I want when the user input only letter q an error message...
ADVERTISEMENT