Question

In: Biology

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start...

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start site) is indicated as the red/bold “g”.

cggctcaataaaataacaggagtctataaaagcgtggggacagttcaggagggggctcgc

TBP binds a cis-acting element within this sequence. What is the coordinate of the 5’ deoxynucleotide of this cis-acting element?

Solutions

Expert Solution

TBP = TATA binding protein.
It is a general transcription factor that binds to the TATA box +30 base upstream to the transcription start site.
TATA box consencus sequence: 5'-TATA(A/T)A(A/T)-3'

Given sequence:

CGGCTCAATAAAATAACAGGAGTCTATAAAAGCGTGGGGACAGTTCAGGAGGGGGCTCGC

The position of TATA box is bold, italic and underlined.

gladiator answered 2 years ago
Next > < Previous

Related Solutions

The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin?
The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin? Select all that are correct.A. Ribosomal subunitsB. A start codonC. DNA polymerase enzymeD. General transcription factorsE. RNA polymerase enzyme
A) The +1 start of transcription is at position 52 of the following sequence. If the...
A) The +1 start of transcription is at position 52 of the following sequence. If the top strand is the coding strand, and the bottom strand is the template strand, write out the transcribed RNA sequence. 5' TACCGAGAGAGGTTGACAAATGCCTAGATTGATGATTATA 3' 3' ATGGCTCTCTCCAACTGTTTACGGATCTAACTACTAATAT 5' 0000000001111111111122222222233333333334 1234567890123456789012345678901234567890 5' TAATTCGGATGAGAGGGTTCAGGACAAGCTTTAGCCCTAT 3' 3' ATTAAGCCTACTCTCCCAAGTCCTGTTCGAAATCGGGATA 5' 4444444445555555555666666666677777777778 1234567890123456789012345678901234567890 (Write the sequence of nucleotides from the start site to the end without spaces or any other characters, just a string of RNA nucleotides)
Eukaryotic gene regulation: transcription initiation Initiation & the transcription initiation complex (including enhancers). Promoter; TATA box;...
Eukaryotic gene regulation: transcription initiation Initiation & the transcription initiation complex (including enhancers). Promoter; TATA box; Conserved & variable regions in promoters. Eukaryotic enhancers. Why is it important that there are multiple control elements in a single enhancer? What binds to the control elements? How is it possible for a small number of activator and transcription factor proteins to regulate a large number of genes? Transcription: Elongation & RNA polymerase. RNA polymerase vs. DNA polymerase. Termination. MyoD: What makes it...
How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? How...
How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? How and why do consensus sequences differ from one another?
A. Draw a typical bacterialgene. Be sure to includeand labelthe promoter, transcription start site, transcription terminator,coding...
A. Draw a typical bacterialgene. Be sure to includeand labelthe promoter, transcription start site, transcription terminator,coding region, and untranslated regions. Below the gene draw a full-length mRNA transcript of the gene. On the mRNA, label the 5’ & 3’ ends, the coding region, and the UTRs. B. Draw a typical eukaryotic gene. Be sure to includeand labelthe core promoter, some proximal promoterelements, one enhancer,transcription start site, two introns, poly(A) addition signal, coding region, and untranslated regions. Below the gene draw...
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...
Eukaryotic transcription factors often bind to DNA at sites long distances from the transcription start site....
Eukaryotic transcription factors often bind to DNA at sites long distances from the transcription start site. These DNA regions are called:
what are the roles of transcription factors and the promoter reguon in transcription?
what are the roles of transcription factors and the promoter reguon in transcription?
Briefly explain how a transcription factor located 10,000 nucleotides upstream of the promoter sequence can influence...
Briefly explain how a transcription factor located 10,000 nucleotides upstream of the promoter sequence can influence gene expression.
What sequence is normally placed between the end of a promoter in the start codon (ATG) to ensure efficient translation?
What sequence is normally placed between the end of a promoter in the start codon (ATG) to ensure efficient translation? include the name of the sequence and an example of it
ADVERTISEMENT
Subjects
ADVERTISEMENT
Latest Questions
ADVERTISEMENT